EMAIL THIS PAGE TO A FRIEND

MVK

mevalonate kinase

89 Gene Product Result for
Synonyms: LRBP MK MVLK POROK3
UniProtKB ID: Q03426
Gene ID:
Human(4598) Summary: This gene encodes the peroxisomal enzyme mevalonate kinase. Mevalonate is a key intermediate, and mevalonate kinase a key early enzyme, in isoprenoid and sterol synthesis. Mevalonate kinase deficiency caused by mutation of this gene results in mevalonic aciduria, a disease characterized psychomotor retardation, failure to thrive, hepatosplenomegaly, anemia and recurrent febrile crises. Defects in this gene also cause hyperimmunoglobulinaemia D and periodic fever syndrome, a disorder characterized by recurrent episodes of fever associated with lymphadenopathy, arthralgia, gastrointestinal dismay and skin rash. Two transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17855) mevalonate kinase
Rat(81727) mevalonate kinase
Zebrafish(492477) mevalonate kinase
cow(505792) mevalonate kinase
domestic cat(101085666) mevalonate kinase
dog(486309) mevalonate kinase
chicken(768555) mevalonate kinase
naked mole-rat(101707794) mevalonate kinase
Domestic Rabbit(100340365) mevalonate kinase
domestic guinea pig(100714338) mevalonate kinase
sheep(101113796) mevalonate kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000431 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000431 Rosetta Predictions human pricing
NM_001114185 Rosetta Predictions human pricing
NM_031063 Rosetta Predictions rat pricing
NM_023556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066098 predicted 658
2 SASI_Hs01_00066099 predicted 1603
3 SASI_Hs01_00066100 predicted 1159
4 SASI_Hs01_00066101 predicted 1560
5 SASI_Hs01_00066102 predicted 893
6 SASI_Hs01_00066103 predicted 848
7 SASI_Hs01_00066104 predicted 1380
8 SASI_Hs01_00066105 predicted 769
9 SASI_Hs02_00302540 predicted 942
10 SASI_Hs02_00302541 predicted 1054
11 SASI_Hs01_00066097 predicted 612
12 SASI_Hs01_00066106 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326484 predicted 648
2 SASI_Hs02_00326485 predicted 1593
3 SASI_Hs02_00326486 predicted 1151
4 SASI_Hs02_00326487 predicted 1545
5 SASI_Hs02_00326488 predicted 891
6 SASI_Hs02_00326489 predicted 834
7 SASI_Hs02_00326490 predicted 1370
8 SASI_Hs02_00326491 predicted 751
9 SASI_Hs02_00326492 predicted 930
10 SASI_Hs02_00326493 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085993 predicted 618
2 SASI_Rn01_00085994 predicted 1342
3 SASI_Rn01_00085995 predicted 1281
4 SASI_Rn01_00085996 predicted 1111
5 SASI_Rn01_00085997 predicted 1419
6 SASI_Rn01_00085998 predicted 1326
7 SASI_Rn01_00085999 predicted 832
8 SASI_Rn01_00086001 predicted 656
9 SASI_Rn02_00264302 predicted 882
10 SASI_Rn02_00264303 predicted 985
11 SASI_Rn01_00085992 predicted 217
12 SASI_Rn01_00086000 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107908 predicted 211
2 SASI_Mm01_00107909 predicted 1275
3 SASI_Mm01_00107910 predicted 944
4 SASI_Mm01_00107911 predicted 934
5 SASI_Mm01_00107912 predicted 455
6 SASI_Mm01_00107913 predicted 645
7 SASI_Mm01_00107914 predicted 223
8 SASI_Mm01_00107915 predicted 272
9 SASI_Mm01_00107916 predicted 943
10 SASI_Mm01_00107917 predicted 1339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000431
VALIDATED
MVK MISSION shRNA Bacterial Glycerol Stock
mevalonate kinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-730s21c1
Sequence:CCGGGGAGGATTTGGAGCTAATTAACTCGAGTTAATTAGCTCCAAATCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-837s21c1
Sequence:CCGGGATACCATCAAGGGAAGATTTCTCGAGAAATCTTCCCTTGATGGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000431.1-1499s1c1
Sequence:UNK
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000431.2-729s1c1
Sequence:CCGGAGGAGGATTTGGAGCTAATTACTCGAGTAATTAGCTCCAAATCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-287s21c1
Sequence:CCGGTCCTTGAACTTGAGAACATTCCTCGAGGAATGTTCTCAAGTTCAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-900s21c1
Sequence:CCGGACACCAAAGTCCCTCGCAATACTCGAGTATTGCGAGGGACTTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000431.1-1787s1c1
Sequence:CCGGCCCTTCTACCTAGCGGGATGGCTCGAGCCATCCCGCTAGGTAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000431.1-728s1c1
Sequence:CCGGCAAGGGAAGATTTCATCCTTACTCGAGTAAGGATGAAATCTTCCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000431.x-403s1c1
Sequence:CCGGGCTGGCCTTTCTTTACTTATACTCGAGTATAAGTAAAGAAAGGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000431.x-769s1c1
Sequence:CCGGGATCCTGCTGACCAACACCAACTCGAGTTGGTGTTGGTCAGCAGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000431
VALIDATED
MVK MISSION shRNA shRNA Plasmid DNA
mevalonate kinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-730s21c1
Sequence:CCGGGGAGGATTTGGAGCTAATTAACTCGAGTTAATTAGCTCCAAATCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-837s21c1
Sequence:CCGGGATACCATCAAGGGAAGATTTCTCGAGAAATCTTCCCTTGATGGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000431.1-1499s1c1
Sequence:UNK
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000431.2-729s1c1
Sequence:CCGGAGGAGGATTTGGAGCTAATTACTCGAGTAATTAGCTCCAAATCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-287s21c1
Sequence:CCGGTCCTTGAACTTGAGAACATTCCTCGAGGAATGTTCTCAAGTTCAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-900s21c1
Sequence:CCGGACACCAAAGTCCCTCGCAATACTCGAGTATTGCGAGGGACTTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000431.1-1787s1c1
Sequence:CCGGCCCTTCTACCTAGCGGGATGGCTCGAGCCATCCCGCTAGGTAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000431.1-728s1c1
Sequence:CCGGCAAGGGAAGATTTCATCCTTACTCGAGTAAGGATGAAATCTTCCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000431.x-403s1c1
Sequence:CCGGGCTGGCCTTTCTTTACTTATACTCGAGTATAAGTAAAGAAAGGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000431.x-769s1c1
Sequence:CCGGGATCCTGCTGACCAACACCAACTCGAGTTGGTGTTGGTCAGCAGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000431
VALIDATED
MVK MISSION shRNA Lentiviral Transduction Particles
mevalonate kinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-730s21c1
Sequence:CCGGGGAGGATTTGGAGCTAATTAACTCGAGTTAATTAGCTCCAAATCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-837s21c1
Sequence:CCGGGATACCATCAAGGGAAGATTTCTCGAGAAATCTTCCCTTGATGGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000431.1-1499s1c1
Sequence:UNK
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000431.2-729s1c1
Sequence:CCGGAGGAGGATTTGGAGCTAATTACTCGAGTAATTAGCTCCAAATCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-287s21c1
Sequence:CCGGTCCTTGAACTTGAGAACATTCCTCGAGGAATGTTCTCAAGTTCAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000431.2-900s21c1
Sequence:CCGGACACCAAAGTCCCTCGCAATACTCGAGTATTGCGAGGGACTTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000431.1-1787s1c1
Sequence:CCGGCCCTTCTACCTAGCGGGATGGCTCGAGCCATCCCGCTAGGTAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000431.1-728s1c1
Sequence:CCGGCAAGGGAAGATTTCATCCTTACTCGAGTAAGGATGAAATCTTCCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000431.x-403s1c1
Sequence:CCGGGCTGGCCTTTCTTTACTTATACTCGAGTATAAGTAAAGAAAGGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000431.x-769s1c1
Sequence:CCGGGATCCTGCTGACCAACACCAACTCGAGTTGGTGTTGGTCAGCAGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023556
VALIDATED
MVK MISSION shRNA Bacterial Glycerol Stock
mevalonate kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-1341s21c1
Sequence:CCGGTCATCCGTGTTCTGCCGTTTCCTCGAGGAAACGGCAGAACACGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-945s21c1
Sequence:CCGGCCTCGTACTAGAAGAGCTGATCTCGAGATCAGCTCTTCTAGTACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023556.2-219s21c1
Sequence:CCGGGAGCGTCAATTTACCCAACATCTCGAGATGTTGGGTAAATTGACGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-1282s21c1
Sequence:CCGGACCAAGAAGCCTCTAAGTATCCTCGAGGATACTTAGAGGCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023556.2-668s21c1
Sequence:CCGGACCCTTCTGGTGTGGACAATGCTCGAGCATTGTCCACACCAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-865s1c1
Sequence:CCGGCTGACCTCCATTGACGCAATACTCGAGTATTGCGTCAATGGAGGTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-219s1c1
Sequence:CCGGGAGCGTCAATTTACCCAACATCTCGAGATGTTGGGTAAATTGACGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023556.2-164s1c1
Sequence:CCGGCGGCCTTGAACTTGAGAACTTCTCGAGAAGTTCTCAAGTTCAAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023556.2-605s1c1
Sequence:CCGGCCGAGGAAGATCTGAAGTCAACTCGAGTTGACTTCAGATCTTCCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-945s1c1
Sequence:CCGGCCTCGTACTAGAAGAGCTGATCTCGAGATCAGCTCTTCTAGTACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023556
VALIDATED
MVK MISSION shRNA shRNA Plasmid DNA
mevalonate kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-1341s21c1
Sequence:CCGGTCATCCGTGTTCTGCCGTTTCCTCGAGGAAACGGCAGAACACGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-945s21c1
Sequence:CCGGCCTCGTACTAGAAGAGCTGATCTCGAGATCAGCTCTTCTAGTACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023556.2-219s21c1
Sequence:CCGGGAGCGTCAATTTACCCAACATCTCGAGATGTTGGGTAAATTGACGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-1282s21c1
Sequence:CCGGACCAAGAAGCCTCTAAGTATCCTCGAGGATACTTAGAGGCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023556.2-668s21c1
Sequence:CCGGACCCTTCTGGTGTGGACAATGCTCGAGCATTGTCCACACCAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-865s1c1
Sequence:CCGGCTGACCTCCATTGACGCAATACTCGAGTATTGCGTCAATGGAGGTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-219s1c1
Sequence:CCGGGAGCGTCAATTTACCCAACATCTCGAGATGTTGGGTAAATTGACGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023556.2-164s1c1
Sequence:CCGGCGGCCTTGAACTTGAGAACTTCTCGAGAAGTTCTCAAGTTCAAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023556.2-605s1c1
Sequence:CCGGCCGAGGAAGATCTGAAGTCAACTCGAGTTGACTTCAGATCTTCCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-945s1c1
Sequence:CCGGCCTCGTACTAGAAGAGCTGATCTCGAGATCAGCTCTTCTAGTACGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023556
VALIDATED
MVK MISSION shRNA Lentiviral Transduction Particles
mevalonate kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-1341s21c1
Sequence:CCGGTCATCCGTGTTCTGCCGTTTCCTCGAGGAAACGGCAGAACACGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-945s21c1
Sequence:CCGGCCTCGTACTAGAAGAGCTGATCTCGAGATCAGCTCTTCTAGTACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023556.2-219s21c1
Sequence:CCGGGAGCGTCAATTTACCCAACATCTCGAGATGTTGGGTAAATTGACGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023556.2-1282s21c1
Sequence:CCGGACCAAGAAGCCTCTAAGTATCCTCGAGGATACTTAGAGGCTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023556.2-668s21c1
Sequence:CCGGACCCTTCTGGTGTGGACAATGCTCGAGCATTGTCCACACCAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-865s1c1
Sequence:CCGGCTGACCTCCATTGACGCAATACTCGAGTATTGCGTCAATGGAGGTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-219s1c1
Sequence:CCGGGAGCGTCAATTTACCCAACATCTCGAGATGTTGGGTAAATTGACGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023556.2-164s1c1
Sequence:CCGGCGGCCTTGAACTTGAGAACTTCTCGAGAAGTTCTCAAGTTCAAGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023556.2-605s1c1
Sequence:CCGGCCGAGGAAGATCTGAAGTCAACTCGAGTTGACTTCAGATCTTCCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023556.2-945s1c1
Sequence:CCGGCCTCGTACTAGAAGAGCTGATCTCGAGATCAGCTCTTCTAGTACGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)