EMAIL THIS PAGE TO A FRIEND

MVP

major vault protein

62 Gene Product Result for
Synonyms: LRP VAULT1
UniProtKB ID: Q14764, Q96BG4, Q9BPW6, Q9BQT1, Q9UBD1
Gene ID:
Human(9961) Summary: This gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The encoded protein may play a role in multiple cellular processes by regulating the MAP kinase, JAK/STAT and phosphoinositide 3-kinase/Akt signaling pathways. The encoded protein also plays a role in multidrug resistance, and expression of this gene may be a prognostic marker for several types of cancer. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(78388) major vault protein
Rat(64681) major vault protein
Zebrafish(373081) major vault protein
chicken(420049) major vault protein
dog(479783) major vault protein
cow(516456) major vault protein
Horse(100063984) major vault protein
sheep(101119435) major vault protein
domestic guinea pig(100726794) major vault protein
Domestic Rabbit(100340748) major vault protein
naked mole-rat(101716080) major vault protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005115 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005115 Rosetta Predictions human pricing
NM_017458 Rosetta Predictions human pricing
NM_022715 Rosetta Predictions rat pricing
NM_080638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210249 predicted 1165
2 SASI_Hs01_00210250 predicted 2178
3 SASI_Hs01_00210251 predicted 1239
4 SASI_Hs01_00210252 predicted 1274
5 SASI_Hs01_00210253 predicted 1839
6 SASI_Hs01_00210254 predicted 1749
7 SASI_Hs02_00339007 predicted 1834
8 SASI_Hs02_00339008 predicted 1167
9 SASI_Hs01_00210256 predicted 1638
10 SASI_Hs01_00210257 predicted 2458
11 SASI_Hs01_00210255 predicted 1399
12 SASI_Hs01_00210258 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065280 predicted 1209
2 SASI_Hs01_00065281 predicted 2215
3 SASI_Hs01_00065282 predicted 1274
4 SASI_Hs01_00065283 predicted 1309
5 SASI_Hs01_00065284 predicted 1872
6 SASI_Hs01_00065285 predicted 1780
7 SASI_Hs02_00350085 predicted 1876
8 SASI_Hs02_00350086 predicted 1204
9 SASI_Hs01_00065287 predicted 1677
10 SASI_Hs01_00065288 predicted 2496
11 SASI_Hs01_00065286 predicted 1434
12 SASI_Hs01_00065289 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030051 predicted 1255
2 SASI_Rn01_00030052 predicted 1685
3 SASI_Rn01_00030053 predicted 1813
4 SASI_Rn01_00030054 predicted 824
5 SASI_Rn01_00030055 predicted 1148
6 SASI_Rn01_00030056 predicted 1411
7 SASI_Rn01_00030057 predicted 1613
8 SASI_Rn01_00030058 predicted 1626
9 SASI_Rn02_00263551 predicted 2133
10 SASI_Rn01_00030060 predicted 896
11 SASI_Rn01_00030059 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151352 predicted 1854
2 SASI_Mm01_00151353 predicted 1532
3 SASI_Mm01_00151354 predicted 1884
4 SASI_Mm01_00151355 predicted 1873
5 SASI_Mm01_00151356 predicted 2577
6 SASI_Mm01_00151357 predicted 1455
7 SASI_Mm01_00151358 predicted 528
8 SASI_Mm01_00151359 predicted 1404
9 SASI_Mm01_00151360 predicted 1655
10 SASI_Mm01_00151361 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005115
VALIDATED
MVP MISSION shRNA Bacterial Glycerol Stock
major vault protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1842s1c1
Sequence:CCGGCACTTTCGATGACTTCCATAACTCGAGTTATGGAAGTCATCGAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005115.3-1840s1c1
Sequence:CCGGGTCACTTTCGATGACTTCCATCTCGAGATGGAAGTCATCGAAAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-117s1c1
Sequence:CCGGCCCATACCACTATATCCATGTCTCGAGACATGGATATAGTGGTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1774s1c1
Sequence:CCGGGTGCCAGACTTTGTAGGTGATCTCGAGATCACCTACAAAGTCTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-2596s1c1
Sequence:CCGGCCCATCAACCTCTTCAACACACTCGAGTGTGTTGAAGAGGTTGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1722s1c1
Sequence:CCGGCTTTGAGGTGAATGACCGGAACTCGAGTTCCGGTCATTCACCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-117s21c1
Sequence:CCGGCCCATACCACTATATCCATGTCTCGAGACATGGATATAGTGGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-1774s21c1
Sequence:CCGGGTGCCAGACTTTGTAGGTGATCTCGAGATCACCTACAAAGTCTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-2596s21c1
Sequence:CCGGCCCATCAACCTCTTCAACACACTCGAGTGTGTTGAAGAGGTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-1842s21c1
Sequence:CCGGCACTTTCGATGACTTCCATAACTCGAGTTATGGAAGTCATCGAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005115
VALIDATED
MVP MISSION shRNA shRNA Plasmid DNA
major vault protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1842s1c1
Sequence:CCGGCACTTTCGATGACTTCCATAACTCGAGTTATGGAAGTCATCGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005115.3-1840s1c1
Sequence:CCGGGTCACTTTCGATGACTTCCATCTCGAGATGGAAGTCATCGAAAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-117s1c1
Sequence:CCGGCCCATACCACTATATCCATGTCTCGAGACATGGATATAGTGGTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1774s1c1
Sequence:CCGGGTGCCAGACTTTGTAGGTGATCTCGAGATCACCTACAAAGTCTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-2596s1c1
Sequence:CCGGCCCATCAACCTCTTCAACACACTCGAGTGTGTTGAAGAGGTTGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1722s1c1
Sequence:CCGGCTTTGAGGTGAATGACCGGAACTCGAGTTCCGGTCATTCACCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-117s21c1
Sequence:CCGGCCCATACCACTATATCCATGTCTCGAGACATGGATATAGTGGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-1774s21c1
Sequence:CCGGGTGCCAGACTTTGTAGGTGATCTCGAGATCACCTACAAAGTCTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-2596s21c1
Sequence:CCGGCCCATCAACCTCTTCAACACACTCGAGTGTGTTGAAGAGGTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-1842s21c1
Sequence:CCGGCACTTTCGATGACTTCCATAACTCGAGTTATGGAAGTCATCGAAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005115
VALIDATED
MVP MISSION shRNA Lentiviral Transduction Particles
major vault protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1842s1c1
Sequence:CCGGCACTTTCGATGACTTCCATAACTCGAGTTATGGAAGTCATCGAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005115.3-1840s1c1
Sequence:CCGGGTCACTTTCGATGACTTCCATCTCGAGATGGAAGTCATCGAAAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-117s1c1
Sequence:CCGGCCCATACCACTATATCCATGTCTCGAGACATGGATATAGTGGTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1774s1c1
Sequence:CCGGGTGCCAGACTTTGTAGGTGATCTCGAGATCACCTACAAAGTCTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-2596s1c1
Sequence:CCGGCCCATCAACCTCTTCAACACACTCGAGTGTGTTGAAGAGGTTGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005115.3-1722s1c1
Sequence:CCGGCTTTGAGGTGAATGACCGGAACTCGAGTTCCGGTCATTCACCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-117s21c1
Sequence:CCGGCCCATACCACTATATCCATGTCTCGAGACATGGATATAGTGGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-1774s21c1
Sequence:CCGGGTGCCAGACTTTGTAGGTGATCTCGAGATCACCTACAAAGTCTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-2596s21c1
Sequence:CCGGCCCATCAACCTCTTCAACACACTCGAGTGTGTTGAAGAGGTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005115.3-1842s21c1
Sequence:CCGGCACTTTCGATGACTTCCATAACTCGAGTTATGGAAGTCATCGAAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080638
VALIDATED
MVP MISSION shRNA Bacterial Glycerol Stock
major vault protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080638.1-572s1c1
Sequence:CCGGGTGGAAGTCGTGGAGATCATTCTCGAGAATGATCTCCACGACTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080638.1-308s1c1
Sequence:CCGGGCCCAGAGTTCTGTGTTGTTTCTCGAGAAACAACACAGAACTCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080638.1-1892s1c1
Sequence:CCGGCGTATCATTCGCATGGCTGTTCTCGAGAACAGCCATGCGAATGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080638.1-2085s1c1
Sequence:CCGGCCATCGAAATTACAACCAACTCTCGAGAGTTGGTTGTAATTTCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080638.1-1263s1c1
Sequence:CCGGGCATCTATGTTCAGGATGTCACTCGAGTGACATCCTGAACATAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-2083s21c1
Sequence:CCGGCCATCGAAATTACAACCAACTCTCGAGAGTTGGTTGTAATTTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-1890s21c1
Sequence:CCGGCGTATCATTCGCATGGCTGTTCTCGAGAACAGCCATGCGAATGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-306s21c1
Sequence:CCGGGCCCAGAGTTCTGTGTTGTTTCTCGAGAAACAACACAGAACTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-1261s21c1
Sequence:CCGGGCATCTATGTTCAGGATGTCACTCGAGTGACATCCTGAACATAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080638
VALIDATED
MVP MISSION shRNA shRNA Plasmid DNA
major vault protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080638.1-572s1c1
Sequence:CCGGGTGGAAGTCGTGGAGATCATTCTCGAGAATGATCTCCACGACTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080638.1-308s1c1
Sequence:CCGGGCCCAGAGTTCTGTGTTGTTTCTCGAGAAACAACACAGAACTCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080638.1-1892s1c1
Sequence:CCGGCGTATCATTCGCATGGCTGTTCTCGAGAACAGCCATGCGAATGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080638.1-2085s1c1
Sequence:CCGGCCATCGAAATTACAACCAACTCTCGAGAGTTGGTTGTAATTTCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080638.1-1263s1c1
Sequence:CCGGGCATCTATGTTCAGGATGTCACTCGAGTGACATCCTGAACATAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-2083s21c1
Sequence:CCGGCCATCGAAATTACAACCAACTCTCGAGAGTTGGTTGTAATTTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-1890s21c1
Sequence:CCGGCGTATCATTCGCATGGCTGTTCTCGAGAACAGCCATGCGAATGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-306s21c1
Sequence:CCGGGCCCAGAGTTCTGTGTTGTTTCTCGAGAAACAACACAGAACTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-1261s21c1
Sequence:CCGGGCATCTATGTTCAGGATGTCACTCGAGTGACATCCTGAACATAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080638
VALIDATED
MVP MISSION shRNA Lentiviral Transduction Particles
major vault protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080638.1-572s1c1
Sequence:CCGGGTGGAAGTCGTGGAGATCATTCTCGAGAATGATCTCCACGACTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080638.1-308s1c1
Sequence:CCGGGCCCAGAGTTCTGTGTTGTTTCTCGAGAAACAACACAGAACTCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080638.1-1892s1c1
Sequence:CCGGCGTATCATTCGCATGGCTGTTCTCGAGAACAGCCATGCGAATGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080638.1-2085s1c1
Sequence:CCGGCCATCGAAATTACAACCAACTCTCGAGAGTTGGTTGTAATTTCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080638.1-1263s1c1
Sequence:CCGGGCATCTATGTTCAGGATGTCACTCGAGTGACATCCTGAACATAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-2083s21c1
Sequence:CCGGCCATCGAAATTACAACCAACTCTCGAGAGTTGGTTGTAATTTCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-1890s21c1
Sequence:CCGGCGTATCATTCGCATGGCTGTTCTCGAGAACAGCCATGCGAATGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-306s21c1
Sequence:CCGGGCCCAGAGTTCTGTGTTGTTTCTCGAGAAACAACACAGAACTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080638.2-1261s21c1
Sequence:CCGGGCATCTATGTTCAGGATGTCACTCGAGTGACATCCTGAACATAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)