EMAIL THIS PAGE TO A FRIEND

MX1

myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)

71 Gene Product Result for
Synonyms: IFI-78K IFI78 MX MxA
Gene ID:
Human(4599) Summary: In mouse, the interferon-inducible Mx protein is responsible for a specific antiviral state against influenza virus infection. The protein encoded by this gene is similar to the mouse protein as determined by its antigenic relatedness, induction conditions, physicochemical properties, and amino acid analysis. This cytoplasmic protein is a member of both the dynamin family and the family of large GTPases. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(17857) myxovirus (influenza virus) resistance 1
Rat(24575) myxovirus (influenza virus) resistance 1
chicken(395313) myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
domestic cat(101085996) myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Horse(100034192) myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
cow(280872) myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
dog(403745) myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
sheep(443146) myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025871 MISSION® esiRNA esiRNA human MX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002462 Rosetta Predictions human pricing
NM_173096 Rosetta Predictions rat pricing
NM_010846 Rosetta Predictions mouse pricing
NR_003520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056299 predicted 899
2 SASI_Hs02_00333883 predicted 1476
3 SASI_Hs01_00056300 predicted 916
4 SASI_Hs01_00056302 predicted 1149
5 SASI_Hs01_00056303 predicted 400
6 SASI_Hs01_00056304 predicted 2428
7 SASI_Hs02_00333884 predicted 923
8 SASI_Hs01_00056305 predicted 1684
9 SASI_Hs01_00056306 predicted 809
10 SASI_Hs01_00056307 predicted 2403
11 SASI_Hs01_00056301 predicted 1583
12 SASI_Hs01_00056308 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040745 predicted 758
2 SASI_Rn01_00040746 predicted 2257
3 SASI_Rn01_00040747 predicted 1591
4 SASI_Rn01_00040748 predicted 2245
5 SASI_Rn01_00040749 predicted 2362
6 SASI_Rn01_00040750 predicted 1619
7 SASI_Rn01_00040751 predicted 2144
8 SASI_Rn02_00269244 predicted 1778
9 SASI_Rn01_00040753 predicted 2063
10 SASI_Rn02_00269245 predicted 1378
11 SASI_Rn01_00040752 predicted 2277
12 SASI_Rn01_00040754 predicted 1572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166144 predicted 1126
2 SASI_Mm01_00166145 predicted 1542
3 SASI_Mm01_00166146 predicted 1547
4 SASI_Mm01_00166147 predicted 2102
5 SASI_Mm01_00166148 predicted 1602
6 SASI_Mm01_00166149 predicted 2095
7 SASI_Mm01_00166151 predicted 1025
8 SASI_Mm02_00319493 predicted 2181
9 SASI_Mm01_00166152 predicted 1985
10 SASI_Mm01_00166153 predicted 1346
11 SASI_Mm01_00166150 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353417 predicted 1360
2 SASI_Mm02_00353418 predicted 2174
3 SASI_Mm02_00353419 predicted 1021
4 SASI_Mm02_00353420 predicted 2227
5 SASI_Mm02_00353421 predicted 1580
6 SASI_Mm02_00353422 predicted 1028
7 SASI_Mm02_00353423 predicted 1079
8 SASI_Mm02_00353424 predicted 1574
9 SASI_Mm02_00353425 predicted 1662
10 SASI_Mm02_00353426 predicted 2328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002462
VALIDATED
MX1 MISSION shRNA Bacterial Glycerol Stock
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002462.3-987s21c1
Sequence:CCGGGGAATCAGTCATGAGCTAATCCTCGAGGATTAGCTCATGACTGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2711s21c1
Sequence:CCGGACATGAGCTGGCGGGATTGAACTCGAGTTCAATCCCGCCAGCTCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2667s21c1
Sequence:CCGGCAGTTTGGTTTCTAGCATGAACTCGAGTTCATGCTAGAAACCAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2630s21c1
Sequence:CCGGCCGTTAGCCGTGGTGATTTAGCTCGAGCTAAATCACCACGGCTAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002462.3-1937s21c1
Sequence:CCGGGCTACACACCGTGACGGATATCTCGAGATATCCGTCACGGTGTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-400s1c1
Sequence:CCGGCCTCTATTACTGAATGGAGATCTCGAGATCTCCATTCAGTAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1578s1c1
Sequence:CCGGCCACAAATGGAGTACAATAATCTCGAGATTATTGTACTCCATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1685s1c1
Sequence:CCGGGCTTTGTGAATTACAGGACATCTCGAGATGTCCTGTAATTCACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002462.2-915s1c1
Sequence:CCGGGCCTGCTGACATTGGGTATAACTCGAGTTATACCCAATGTCAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1786s1c1
Sequence:CCGGCGGCTTGCTTTCACAGATGTTCTCGAGAACATCTGTGAAAGCAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002462
VALIDATED
MX1 MISSION shRNA shRNA Plasmid DNA
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002462.3-987s21c1
Sequence:CCGGGGAATCAGTCATGAGCTAATCCTCGAGGATTAGCTCATGACTGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2711s21c1
Sequence:CCGGACATGAGCTGGCGGGATTGAACTCGAGTTCAATCCCGCCAGCTCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2667s21c1
Sequence:CCGGCAGTTTGGTTTCTAGCATGAACTCGAGTTCATGCTAGAAACCAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2630s21c1
Sequence:CCGGCCGTTAGCCGTGGTGATTTAGCTCGAGCTAAATCACCACGGCTAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002462.3-1937s21c1
Sequence:CCGGGCTACACACCGTGACGGATATCTCGAGATATCCGTCACGGTGTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-400s1c1
Sequence:CCGGCCTCTATTACTGAATGGAGATCTCGAGATCTCCATTCAGTAATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1578s1c1
Sequence:CCGGCCACAAATGGAGTACAATAATCTCGAGATTATTGTACTCCATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1685s1c1
Sequence:CCGGGCTTTGTGAATTACAGGACATCTCGAGATGTCCTGTAATTCACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002462.2-915s1c1
Sequence:CCGGGCCTGCTGACATTGGGTATAACTCGAGTTATACCCAATGTCAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1786s1c1
Sequence:CCGGCGGCTTGCTTTCACAGATGTTCTCGAGAACATCTGTGAAAGCAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002462
VALIDATED
MX1 MISSION shRNA Lentiviral Transduction Particles
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002462.3-987s21c1
Sequence:CCGGGGAATCAGTCATGAGCTAATCCTCGAGGATTAGCTCATGACTGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2711s21c1
Sequence:CCGGACATGAGCTGGCGGGATTGAACTCGAGTTCAATCCCGCCAGCTCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2667s21c1
Sequence:CCGGCAGTTTGGTTTCTAGCATGAACTCGAGTTCATGCTAGAAACCAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002462.3-2630s21c1
Sequence:CCGGCCGTTAGCCGTGGTGATTTAGCTCGAGCTAAATCACCACGGCTAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002462.3-1937s21c1
Sequence:CCGGGCTACACACCGTGACGGATATCTCGAGATATCCGTCACGGTGTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-400s1c1
Sequence:CCGGCCTCTATTACTGAATGGAGATCTCGAGATCTCCATTCAGTAATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1578s1c1
Sequence:CCGGCCACAAATGGAGTACAATAATCTCGAGATTATTGTACTCCATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1685s1c1
Sequence:CCGGGCTTTGTGAATTACAGGACATCTCGAGATGTCCTGTAATTCACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002462.2-915s1c1
Sequence:CCGGGCCTGCTGACATTGGGTATAACTCGAGTTATACCCAATGTCAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002462.2-1786s1c1
Sequence:CCGGCGGCTTGCTTTCACAGATGTTCTCGAGAACATCTGTGAAAGCAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010846
MX1 MISSION shRNA Bacterial Glycerol Stock
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010846.1-1383s21c1
Sequence:CCGGAGATTCTCCTGAGGTACAAAGCTCGAGCTTTGTACCTCAGGAGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010846.1-2136s21c1
Sequence:CCGGTCGCTGTGCAATGATCCTTTACTCGAGTAAAGGATCATTGCACAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010846.1-2625s1c1
Sequence:CCGGCCCATAACAAACACCAAGTATCTCGAGATACTTGGTGTTTGTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-1129s1c1
Sequence:CCGGCCACTATTGGAAGATCAAATACTCGAGTATTTGATCTTCCAATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-1024s1c1
Sequence:CCGGGATCACTCATACTTCAGCATTCTCGAGAATGCTGAAGTATGAGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-2088s1c1
Sequence:CCGGGCTTGCCAAATTCTCCGATTACTCGAGTAATCGGAGAATTTGGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-882s1c1
Sequence:CCGGAGGCAAGGTCTTGGATGTGATCTCGAGATCACATCCAAGACCTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010846
MX1 MISSION shRNA shRNA Plasmid DNA
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010846.1-1383s21c1
Sequence:CCGGAGATTCTCCTGAGGTACAAAGCTCGAGCTTTGTACCTCAGGAGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010846.1-2136s21c1
Sequence:CCGGTCGCTGTGCAATGATCCTTTACTCGAGTAAAGGATCATTGCACAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010846.1-2625s1c1
Sequence:CCGGCCCATAACAAACACCAAGTATCTCGAGATACTTGGTGTTTGTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-1129s1c1
Sequence:CCGGCCACTATTGGAAGATCAAATACTCGAGTATTTGATCTTCCAATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-1024s1c1
Sequence:CCGGGATCACTCATACTTCAGCATTCTCGAGAATGCTGAAGTATGAGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-2088s1c1
Sequence:CCGGGCTTGCCAAATTCTCCGATTACTCGAGTAATCGGAGAATTTGGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-882s1c1
Sequence:CCGGAGGCAAGGTCTTGGATGTGATCTCGAGATCACATCCAAGACCTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010846
MX1 MISSION shRNA Lentiviral Transduction Particles
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010846.1-1383s21c1
Sequence:CCGGAGATTCTCCTGAGGTACAAAGCTCGAGCTTTGTACCTCAGGAGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010846.1-2136s21c1
Sequence:CCGGTCGCTGTGCAATGATCCTTTACTCGAGTAAAGGATCATTGCACAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010846.1-2625s1c1
Sequence:CCGGCCCATAACAAACACCAAGTATCTCGAGATACTTGGTGTTTGTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-1129s1c1
Sequence:CCGGCCACTATTGGAAGATCAAATACTCGAGTATTTGATCTTCCAATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-1024s1c1
Sequence:CCGGGATCACTCATACTTCAGCATTCTCGAGAATGCTGAAGTATGAGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-2088s1c1
Sequence:CCGGGCTTGCCAAATTCTCCGATTACTCGAGTAATCGGAGAATTTGGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010846.1-882s1c1
Sequence:CCGGAGGCAAGGTCTTGGATGTGATCTCGAGATCACATCCAAGACCTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)