EMAIL THIS PAGE TO A FRIEND

MX2

myxovirus (influenza virus) resistance 2 (mouse)

107 Gene Product Result for
Synonyms: MXB
UniProtKB ID: P20592, D3DSI7
Gene ID:
Human(4600) Summary: The protein encoded by this gene has a nuclear and a cytoplasmic form and is a member of both the dynamin family and the family of large GTPases. The nuclear form is localized in a granular pattern in the heterochromatin region beneath the nuclear envelope. A nuclear localization signal (NLS) is present at the amino terminal end of the nuclear form but is lacking in the cytoplasmic form due to use of an alternate translation start codon. This protein is upregulated by interferon-alpha but does not contain the antiviral activity of a similar myxovirus resistance protein 1. [provided by RefSeq, Jul 2008]
Mouse(17858) myxovirus (influenza virus) resistance 2
Rat(286918) myxovirus (influenza virus) resistance 2
naked mole-rat(101716694) myxovirus (influenza virus) resistance 2 (mouse)
sheep(780441) myxovirus (influenza virus) resistance 2 (mouse)
cow(280873) myxovirus (influenza virus) resistance 2 (mouse)
Horse(100058538) myxovirus (influenza virus) resistance 2 (mouse)
domestic cat(101096256) myxovirus (influenza virus) resistance 2 (mouse)
dog(403744) myxovirus (influenza virus) resistance 2 (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137811 MISSION® esiRNA esiRNA human MX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002463 Rosetta Predictions human pricing
NM_134350 Rosetta Predictions rat pricing
NM_013606 Rosetta Predictions mouse pricing
NR_003508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212591 predicted 2120
2 SASI_Hs01_00212592 predicted 2036
3 SASI_Hs01_00212593 predicted 1215
4 SASI_Hs02_00333885 predicted 1950
5 SASI_Hs01_00212594 predicted 2067
6 SASI_Hs01_00212595 predicted 1229
7 SASI_Hs01_00212596 predicted 304
8 SASI_Hs01_00212597 predicted 2174
9 SASI_Hs01_00212598 predicted 1740
10 SASI_Hs01_00212600 predicted 283
11 SASI_Hs01_00212599 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267906 predicted 1509
2 SASI_Rn01_00098932 predicted 1181
3 SASI_Rn01_00098933 predicted 1512
4 SASI_Rn01_00098934 predicted 2077
5 SASI_Rn01_00098936 predicted 1422
6 SASI_Rn01_00098937 predicted 1103
7 SASI_Rn01_00098938 predicted 1194
8 SASI_Rn01_00098939 predicted 482
9 SASI_Rn01_00098940 predicted 537
10 SASI_Rn01_00098941 predicted 1399
11 SASI_Rn01_00098935 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168672 predicted 1296
2 SASI_Mm01_00168673 predicted 1660
3 SASI_Mm01_00168674 predicted 1087
4 SASI_Mm01_00168675 predicted 1421
5 SASI_Mm01_00168676 predicted 1138
6 SASI_Mm01_00168677 predicted 211
7 SASI_Mm01_00168678 predicted 1798
8 SASI_Mm01_00168679 predicted 1609
9 SASI_Mm01_00168680 predicted 1820
10 SASI_Mm01_00168681 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353373 predicted 1303
2 SASI_Mm02_00353374 predicted 1668
3 SASI_Mm02_00353375 predicted 1391
4 SASI_Mm02_00353376 predicted 1425
5 SASI_Mm02_00353377 predicted 1141
6 SASI_Mm02_00353378 predicted 1642
7 SASI_Mm02_00353379 predicted 215
8 SASI_Mm02_00353380 predicted 1801
9 SASI_Mm02_00353381 predicted 1082
10 SASI_Mm02_00353382 predicted 1608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002463
VALIDATED
MX2 MISSION shRNA Bacterial Glycerol Stock
myxovirus (influenza virus) resistance 2 (mouse)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-2028s1c1
Sequence:CCGGGCCAACCAGATCCCATTTATACTCGAGTATAAATGGGATCTGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-1944s1c1
Sequence:CCGGCCCAGTAATGAGTCTTCGGTTCTCGAGAACCGAAGACTCATTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-660s1c1
Sequence:CCGGGTGGAGAAAGAGATACACAAACTCGAGTTTGTGTATCTCTTTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-1692s1c1
Sequence:CCGGGCTTTCATTAACGTGGCCAAACTCGAGTTTGGCCACGTTAATGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002463.1-1262s1c1
Sequence:CCGGCCCGTTGTTAGAAGGACAAATCTCGAGATTTGTCCTTCTAACAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-2210s21c1
Sequence:CCGGGCGACACGCACTCTGTCAATTCTCGAGAATTGACAGAGTGCGTGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002463.1-2633s21c1
Sequence:CCGGCAGCACCTGCAGCATTGTAACCTCGAGGTTACAATGCTGCAGGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-1436s21c1
Sequence:CCGGGGAGAATGAGACCCGTTTATACTCGAGTATAAACGGGTCTCATTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-1488s21c1
Sequence:CCGGGTAGGCATACTTGCAACTAATCTCGAGATTAGTTGCAAGTATGCCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002463
VALIDATED
MX2 MISSION shRNA shRNA Plasmid DNA
myxovirus (influenza virus) resistance 2 (mouse)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-2028s1c1
Sequence:CCGGGCCAACCAGATCCCATTTATACTCGAGTATAAATGGGATCTGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-1944s1c1
Sequence:CCGGCCCAGTAATGAGTCTTCGGTTCTCGAGAACCGAAGACTCATTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-660s1c1
Sequence:CCGGGTGGAGAAAGAGATACACAAACTCGAGTTTGTGTATCTCTTTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-1692s1c1
Sequence:CCGGGCTTTCATTAACGTGGCCAAACTCGAGTTTGGCCACGTTAATGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002463.1-1262s1c1
Sequence:CCGGCCCGTTGTTAGAAGGACAAATCTCGAGATTTGTCCTTCTAACAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-2210s21c1
Sequence:CCGGGCGACACGCACTCTGTCAATTCTCGAGAATTGACAGAGTGCGTGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002463.1-2633s21c1
Sequence:CCGGCAGCACCTGCAGCATTGTAACCTCGAGGTTACAATGCTGCAGGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-1436s21c1
Sequence:CCGGGGAGAATGAGACCCGTTTATACTCGAGTATAAACGGGTCTCATTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-1488s21c1
Sequence:CCGGGTAGGCATACTTGCAACTAATCTCGAGATTAGTTGCAAGTATGCCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002463
VALIDATED
MX2 MISSION shRNA Lentiviral Transduction Particles
myxovirus (influenza virus) resistance 2 (mouse)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-2028s1c1
Sequence:CCGGGCCAACCAGATCCCATTTATACTCGAGTATAAATGGGATCTGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-1944s1c1
Sequence:CCGGCCCAGTAATGAGTCTTCGGTTCTCGAGAACCGAAGACTCATTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-660s1c1
Sequence:CCGGGTGGAGAAAGAGATACACAAACTCGAGTTTGTGTATCTCTTTCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002463.1-1692s1c1
Sequence:CCGGGCTTTCATTAACGTGGCCAAACTCGAGTTTGGCCACGTTAATGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002463.1-1262s1c1
Sequence:CCGGCCCGTTGTTAGAAGGACAAATCTCGAGATTTGTCCTTCTAACAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-2210s21c1
Sequence:CCGGGCGACACGCACTCTGTCAATTCTCGAGAATTGACAGAGTGCGTGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002463.1-2633s21c1
Sequence:CCGGCAGCACCTGCAGCATTGTAACCTCGAGGTTACAATGCTGCAGGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-1436s21c1
Sequence:CCGGGGAGAATGAGACCCGTTTATACTCGAGTATAAACGGGTCTCATTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002463.1-1488s21c1
Sequence:CCGGGTAGGCATACTTGCAACTAATCTCGAGATTAGTTGCAAGTATGCCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013606
MX2 MISSION shRNA Bacterial Glycerol Stock
myxovirus (influenza virus) resistance 2 (mouse)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013606.1-2168s1c1
Sequence:CCGGCCAGCCTTTATGCTCTGATAACTCGAGTTATCAGAGCATAAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1609s1c1
Sequence:CCGGCCAAACTTGAAGACATCAGATCTCGAGATCTGATGTCTTCAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1336s1c1
Sequence:CCGGCCTGGAGTAAGGAGATCGAAACTCGAGTTTCGATCTCCTTACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-146s1c1
Sequence:CCGGAGGCGTTGATTCAGTCAACTTCTCGAGAAGTTGACTGAATCAACGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1434s1c1
Sequence:CCGGCCAGGGTTTGTGAATTACAAACTCGAGTTTGTAATTCACAAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013606.1-1078s21c1
Sequence:CCGGTGACCGCAGAGCTCATCTTACCTCGAGGTAAGATGAGCTCTGCGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013606.1-1289s21c1
Sequence:CCGGAGAGGGAGAATGTCGCCTATTCTCGAGAATAGGCGACATTCTCCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013606
MX2 MISSION shRNA shRNA Plasmid DNA
myxovirus (influenza virus) resistance 2 (mouse)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013606.1-2168s1c1
Sequence:CCGGCCAGCCTTTATGCTCTGATAACTCGAGTTATCAGAGCATAAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1609s1c1
Sequence:CCGGCCAAACTTGAAGACATCAGATCTCGAGATCTGATGTCTTCAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1336s1c1
Sequence:CCGGCCTGGAGTAAGGAGATCGAAACTCGAGTTTCGATCTCCTTACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-146s1c1
Sequence:CCGGAGGCGTTGATTCAGTCAACTTCTCGAGAAGTTGACTGAATCAACGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1434s1c1
Sequence:CCGGCCAGGGTTTGTGAATTACAAACTCGAGTTTGTAATTCACAAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013606.1-1078s21c1
Sequence:CCGGTGACCGCAGAGCTCATCTTACCTCGAGGTAAGATGAGCTCTGCGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013606.1-1289s21c1
Sequence:CCGGAGAGGGAGAATGTCGCCTATTCTCGAGAATAGGCGACATTCTCCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013606
MX2 MISSION shRNA Lentiviral Transduction Particles
myxovirus (influenza virus) resistance 2 (mouse)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013606.1-2168s1c1
Sequence:CCGGCCAGCCTTTATGCTCTGATAACTCGAGTTATCAGAGCATAAAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1609s1c1
Sequence:CCGGCCAAACTTGAAGACATCAGATCTCGAGATCTGATGTCTTCAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1336s1c1
Sequence:CCGGCCTGGAGTAAGGAGATCGAAACTCGAGTTTCGATCTCCTTACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-146s1c1
Sequence:CCGGAGGCGTTGATTCAGTCAACTTCTCGAGAAGTTGACTGAATCAACGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013606.1-1434s1c1
Sequence:CCGGCCAGGGTTTGTGAATTACAAACTCGAGTTTGTAATTCACAAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013606.1-1078s21c1
Sequence:CCGGTGACCGCAGAGCTCATCTTACCTCGAGGTAAGATGAGCTCTGCGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013606.1-1289s21c1
Sequence:CCGGAGAGGGAGAATGTCGCCTATTCTCGAGAATAGGCGACATTCTCCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)