EMAIL THIS PAGE TO A FRIEND

MXD4

MAX dimerization protein 4

75 Gene Product Result for
Synonyms: MAD4 MST149 MSTP149 bHLHc12
UniProtKB ID: Q14582, A2A335, Q5TZX4
Gene ID:
Human(10608) Summary: This gene is a member of the MAD gene family . The MAD genes encode basic helix-loop-helix-leucine zipper proteins that heterodimerize with MAX protein, forming a transcriptional repression complex. The MAD proteins compete for MAX binding with MYC, which heterodimerizes with MAX forming a transcriptional activation complex. Studies in rodents suggest that the MAD genes are tumor suppressors and contribute to the regulation of cell growth in differentiating tissues. [provided by RefSeq, Jul 2008]
Mouse(17122) Max dimerization protein 4
Rat(360961) Max dimerization protein 4
Zebrafish(559531) MAX dimerization protein 4
cow(541116) MAX dimerization protein 4
domestic cat(101084192) MAX dimerization protein 4
dog(488803) MAX dimerization protein 4
chicken(422890) MAX dimerization protein 4
naked mole-rat(101706356) MAX dimerization protein 4
domestic guinea pig(100733796) MAX dimerization protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006454 Rosetta Predictions human pricing
NM_001108364 Rosetta Predictions rat pricing
NM_010753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216963 predicted 714
2 SASI_Hs01_00216964 predicted 504
3 SASI_Hs01_00216965 predicted 219
4 SASI_Hs02_00341597 predicted 317
5 SASI_Hs01_00216966 predicted 320
6 SASI_Hs01_00216967 predicted 129
7 SASI_Hs01_00216968 predicted 938
8 SASI_Hs01_00216969 predicted 187
9 SASI_Hs01_00216970 predicted 929
10 SASI_Hs01_00216971 predicted 937
11 SASI_Hs01_00216972 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237939 predicted 709
2 SASI_Rn02_00237940 predicted 726
3 SASI_Rn02_00237941 predicted 273
4 SASI_Rn02_00237942 predicted 565
5 SASI_Rn02_00237943 predicted 378
6 SASI_Rn02_00237944 predicted 560
7 SASI_Rn02_00237945 predicted 769
8 SASI_Rn02_00237946 predicted 290
9 SASI_Rn02_00237947 predicted 490
10 SASI_Rn02_00237948 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319272 predicted 672
2 SASI_Mm01_00166732 predicted 386
3 SASI_Mm01_00166733 predicted 344
4 SASI_Mm01_00166734 predicted 598
5 SASI_Mm01_00166735 predicted 527
6 SASI_Mm01_00166736 predicted 810
7 SASI_Mm01_00166737 predicted 287
8 SASI_Mm01_00166738 predicted 323
9 SASI_Mm01_00166739 predicted 752
10 SASI_Mm01_00166740 predicted 675
11 SASI_Mm01_00166731 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006454
VALIDATED
MXD4 MISSION shRNA Bacterial Glycerol Stock
MAX dimerization protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006454.2-952s1c1
Sequence:CCGGCCAGAAGTATTAAACGTCATTCTCGAGAATGACGTTTAATACTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-510s1c1
Sequence:CCGGGACATAGAGGGCATGGAGTTTCTCGAGAAACTCCATGCCCTCTATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006454.2-231s1c1
Sequence:CCGGGCCAAACTCAGGCTGTACCTTCTCGAGAAGGTACAGCCTGAGTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-392s1c1
Sequence:CCGGGCAGGAGCATCGTTTCCTGAACTCGAGTTCAGGAAACGATGCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-199s1c1
Sequence:CCGGCTTCACACAACGAGCTAGAAACTCGAGTTTCTAGCTCGTTGTGTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-368s21c1
Sequence:CCGGACTGAGCATCAAGGAGCAGCTCTCGAGAGCTGCTCCTTGATGCTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-498s21c1
Sequence:CCGGGAGCAAGAAGTGGACATAGAGCTCGAGCTCTATGTCCACTTCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-330s21c1
Sequence:CCGGGTGCACATCAAGAAACTGGAGCTCGAGCTCCAGTTTCTTGATGTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006454
VALIDATED
MXD4 MISSION shRNA shRNA Plasmid DNA
MAX dimerization protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006454.2-952s1c1
Sequence:CCGGCCAGAAGTATTAAACGTCATTCTCGAGAATGACGTTTAATACTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-510s1c1
Sequence:CCGGGACATAGAGGGCATGGAGTTTCTCGAGAAACTCCATGCCCTCTATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006454.2-231s1c1
Sequence:CCGGGCCAAACTCAGGCTGTACCTTCTCGAGAAGGTACAGCCTGAGTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-392s1c1
Sequence:CCGGGCAGGAGCATCGTTTCCTGAACTCGAGTTCAGGAAACGATGCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-199s1c1
Sequence:CCGGCTTCACACAACGAGCTAGAAACTCGAGTTTCTAGCTCGTTGTGTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-368s21c1
Sequence:CCGGACTGAGCATCAAGGAGCAGCTCTCGAGAGCTGCTCCTTGATGCTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-498s21c1
Sequence:CCGGGAGCAAGAAGTGGACATAGAGCTCGAGCTCTATGTCCACTTCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-330s21c1
Sequence:CCGGGTGCACATCAAGAAACTGGAGCTCGAGCTCCAGTTTCTTGATGTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006454
VALIDATED
MXD4 MISSION shRNA Lentiviral Transduction Particles
MAX dimerization protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006454.2-952s1c1
Sequence:CCGGCCAGAAGTATTAAACGTCATTCTCGAGAATGACGTTTAATACTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-510s1c1
Sequence:CCGGGACATAGAGGGCATGGAGTTTCTCGAGAAACTCCATGCCCTCTATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006454.2-231s1c1
Sequence:CCGGGCCAAACTCAGGCTGTACCTTCTCGAGAAGGTACAGCCTGAGTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-392s1c1
Sequence:CCGGGCAGGAGCATCGTTTCCTGAACTCGAGTTCAGGAAACGATGCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_006454.2-199s1c1
Sequence:CCGGCTTCACACAACGAGCTAGAAACTCGAGTTTCTAGCTCGTTGTGTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-368s21c1
Sequence:CCGGACTGAGCATCAAGGAGCAGCTCTCGAGAGCTGCTCCTTGATGCTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-498s21c1
Sequence:CCGGGAGCAAGAAGTGGACATAGAGCTCGAGCTCTATGTCCACTTCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006454.2-330s21c1
Sequence:CCGGGTGCACATCAAGAAACTGGAGCTCGAGCTCCAGTTTCTTGATGTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010753
VALIDATED
MXD4 MISSION shRNA Bacterial Glycerol Stock
MAX dimerization protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-671s21c1
Sequence:CCGGTGATGCCGATGACCACTACAGCTCGAGCTGTAGTGGTCATCGGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-1031s1c1
Sequence:CCGGCCCACAATCTGTTCTCAGATTCTCGAGAATCTGAGAACAGATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010753.2-332s1c1
Sequence:CCGGACGAGCTAAACTCAGGCTCTACTCGAGTAGAGCCTGAGTTTAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-506s1c1
Sequence:CCGGTCGCTTCCTAAAGAGACGTTTCTCGAGAAACGTCTCTTTAGGAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-304s1c1
Sequence:CCGGCTTCACACAACGAACTAGAAACTCGAGTTTCTAGTTCGTTGTGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010753.2-425s1c1
Sequence:CCGGGCGTGCTAAGATGCACATCAACTCGAGTTGATGTGCATCTTAGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010753.2-1031s21c1
Sequence:CCGGCCCACAATCTGTTCTCAGATTCTCGAGAATCTGAGAACAGATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-506s21c1
Sequence:CCGGTCGCTTCCTAAAGAGACGTTTCTCGAGAAACGTCTCTTTAGGAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-761s21c1
Sequence:CCGGTTCGTAGGCTCCATGTCCTTTCTCGAGAAAGGACATGGAGCCTACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-601s21c1
Sequence:CCGGCAGAGCAAGAGGTGGATATAGCTCGAGCTATATCCACCTCTTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010753
VALIDATED
MXD4 MISSION shRNA shRNA Plasmid DNA
MAX dimerization protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-671s21c1
Sequence:CCGGTGATGCCGATGACCACTACAGCTCGAGCTGTAGTGGTCATCGGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-1031s1c1
Sequence:CCGGCCCACAATCTGTTCTCAGATTCTCGAGAATCTGAGAACAGATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010753.2-332s1c1
Sequence:CCGGACGAGCTAAACTCAGGCTCTACTCGAGTAGAGCCTGAGTTTAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-506s1c1
Sequence:CCGGTCGCTTCCTAAAGAGACGTTTCTCGAGAAACGTCTCTTTAGGAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-304s1c1
Sequence:CCGGCTTCACACAACGAACTAGAAACTCGAGTTTCTAGTTCGTTGTGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010753.2-425s1c1
Sequence:CCGGGCGTGCTAAGATGCACATCAACTCGAGTTGATGTGCATCTTAGCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010753.2-1031s21c1
Sequence:CCGGCCCACAATCTGTTCTCAGATTCTCGAGAATCTGAGAACAGATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-506s21c1
Sequence:CCGGTCGCTTCCTAAAGAGACGTTTCTCGAGAAACGTCTCTTTAGGAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-761s21c1
Sequence:CCGGTTCGTAGGCTCCATGTCCTTTCTCGAGAAAGGACATGGAGCCTACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-601s21c1
Sequence:CCGGCAGAGCAAGAGGTGGATATAGCTCGAGCTATATCCACCTCTTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010753
VALIDATED
MXD4 MISSION shRNA Lentiviral Transduction Particles
MAX dimerization protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-671s21c1
Sequence:CCGGTGATGCCGATGACCACTACAGCTCGAGCTGTAGTGGTCATCGGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-1031s1c1
Sequence:CCGGCCCACAATCTGTTCTCAGATTCTCGAGAATCTGAGAACAGATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010753.2-332s1c1
Sequence:CCGGACGAGCTAAACTCAGGCTCTACTCGAGTAGAGCCTGAGTTTAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-506s1c1
Sequence:CCGGTCGCTTCCTAAAGAGACGTTTCTCGAGAAACGTCTCTTTAGGAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010753.2-304s1c1
Sequence:CCGGCTTCACACAACGAACTAGAAACTCGAGTTTCTAGTTCGTTGTGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010753.2-425s1c1
Sequence:CCGGGCGTGCTAAGATGCACATCAACTCGAGTTGATGTGCATCTTAGCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010753.2-1031s21c1
Sequence:CCGGCCCACAATCTGTTCTCAGATTCTCGAGAATCTGAGAACAGATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-506s21c1
Sequence:CCGGTCGCTTCCTAAAGAGACGTTTCTCGAGAAACGTCTCTTTAGGAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-761s21c1
Sequence:CCGGTTCGTAGGCTCCATGTCCTTTCTCGAGAAAGGACATGGAGCCTACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010753.2-601s21c1
Sequence:CCGGCAGAGCAAGAGGTGGATATAGCTCGAGCTATATCCACCTCTTGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)