EMAIL THIS PAGE TO A FRIEND

MXI1

MAX interactor 1, dimerization protein

262 Gene Product Result for
Synonyms: MAD2 MXD2 MXI bHLHc11
Gene ID:
Human(4601) Summary: Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally. [provided by RefSeq, Jul 2008]
Mouse(17859) Max interacting protein 1
Rat(25701) MAX interactor 1
Zebrafish(30485) max interacting protein
dog(609946) MAX interactor 1
chicken(423888) MAX interactor 1
domestic cat(101092646) MAX interactor 1
cow(614509) MAX interactor 1
domestic guinea pig(100733154) MAX interactor 1, dimerization protein
naked mole-rat(101697683) MAX interactor 1, dimerization protein
sheep(101118067) MAX interactor 1, dimerization protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008541 Rosetta Predictions human pricing
NM_005962 Rosetta Predictions human pricing
NM_130439 Rosetta Predictions human pricing
NM_013160 Rosetta Predictions rat pricing
NM_001008542 Rosetta Predictions mouse pricing
NM_001008543 Rosetta Predictions mouse pricing
NM_010847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205944 predicted 437
2 SASI_Hs01_00205945 predicted 726
3 SASI_Hs01_00205946 predicted 675
4 SASI_Hs01_00205947 predicted 527
5 SASI_Hs01_00205948 predicted 322
6 SASI_Hs01_00205949 predicted 644
7 SASI_Hs01_00205950 predicted 486
8 SASI_Hs01_00205951 predicted 702
9 SASI_Hs01_00205952 predicted 482
10 SASI_Hs01_00205953 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139543 predicted 666
2 SASI_Hs01_00139544 predicted 945
3 SASI_Hs01_00139545 predicted 895
4 SASI_Hs01_00139546 predicted 750
5 SASI_Hs01_00139547 predicted 538
6 SASI_Hs01_00139548 predicted 870
7 SASI_Hs01_00139549 predicted 709
8 SASI_Hs01_00139550 predicted 933
9 SASI_Hs01_00139551 predicted 710
10 SASI_Hs01_00139552 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206931 predicted 859
2 SASI_Hs01_00206932 predicted 1150
3 SASI_Hs01_00206933 predicted 1098
4 SASI_Hs01_00206934 predicted 952
5 SASI_Hs01_00206935 predicted 738
6 SASI_Hs01_00206936 predicted 1069
7 SASI_Hs01_00206937 predicted 915
8 SASI_Hs01_00206938 predicted 1131
9 SASI_Hs01_00206939 predicted 913
10 SASI_Hs01_00206940 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064952 predicted 1041
2 SASI_Rn02_00260975 predicted 438
3 SASI_Rn01_00064954 predicted 541
4 SASI_Rn01_00064955 predicted 959
5 SASI_Rn01_00064956 predicted 951
6 SASI_Rn01_00064957 predicted 1156
7 SASI_Rn01_00064958 predicted 865
8 SASI_Rn01_00064959 predicted 1058
9 SASI_Rn01_00064960 predicted 1015
10 SASI_Rn01_00064961 predicted 386
11 SASI_Rn01_00064953 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080381 predicted 1118
2 SASI_Mm01_00080383 predicted 1031
3 SASI_Mm02_00286810 predicted 915
4 SASI_Mm01_00080384 predicted 1334
5 SASI_Mm02_00286811 predicted 731
6 SASI_Mm01_00080385 predicted 1489
7 SASI_Mm01_00080387 predicted 1216
8 SASI_Mm02_00286812 predicted 939
9 SASI_Mm01_00080388 predicted 1135
10 SASI_Mm01_00080389 predicted 1413
11 SASI_Mm01_00080382 predicted 1508
12 SASI_Mm01_00080386 predicted 1256
13 SASI_Mm01_00080390 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286813 predicted 331
2 SASI_Mm02_00286814 predicted 328
3 SASI_Mm01_00025222 predicted 810
4 SASI_Mm01_00025224 predicted 720
5 SASI_Mm02_00286815 predicted 606
6 SASI_Mm01_00025225 predicted 1021
7 SASI_Mm02_00286816 predicted 422
8 SASI_Mm02_00286817 predicted 588
9 SASI_Mm01_00025228 predicted 898
10 SASI_Mm02_00286818 predicted 624
11 SASI_Mm01_00025223 predicted 1200
12 SASI_Mm01_00025226 predicted 1183
13 SASI_Mm01_00025227 predicted 959
14 SASI_Mm01_00025229 predicted 826
15 SASI_Mm01_00025230 predicted 1099
16 SASI_Mm01_00025231 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055453 predicted 967
2 SASI_Mm01_00055455 predicted 876
3 SASI_Mm02_00319494 predicted 761
4 SASI_Mm01_00055456 predicted 1169
5 SASI_Mm02_00319495 predicted 574
6 SASI_Mm01_00055457 predicted 1328
7 SASI_Mm01_00055459 predicted 1051
8 SASI_Mm02_00319496 predicted 783
9 SASI_Mm01_00055460 predicted 979
10 SASI_Mm01_00055461 predicted 1251
11 SASI_Mm01_00055454 predicted 1200
12 SASI_Mm01_00055458 predicted 960
13 SASI_Mm01_00055462 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005962
VALIDATED
MXI1 MISSION shRNA Bacterial Glycerol Stock
MAX interactor 1, dimerization protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005962.4-1273s21c1
Sequence:CCGGGAACCCTTCCTGAGCTTTATGCTCGAGCATAAAGCTCAGGAAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005962.4-1455s21c1
Sequence:CCGGGCTCATTTCATGCTCTGCAAACTCGAGTTTGCAGAGCATGAAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-769s21c1
Sequence:CCGGCATGGAGAAGTGGACAATATACTCGAGTATATTGTCCACTTCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-682s21c1
Sequence:CCGGGACAGCATTGGATCAACTATTCTCGAGAATAGTTGATCCAATGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-655s21c1
Sequence:CCGGCCTCAGGAGATGGAACGAATACTCGAGTATTCGTTCCATCTCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-547s21c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-1555s1c1
Sequence:CCGGGCTCATTTCATGCTCTGCAAACTCGAGTTTGCAGAGCATGAAATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-755s1c1
Sequence:CCGGCCTCAGGAGATGGAACGAATACTCGAGTATTCGTTCCATCTCCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-647s1c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005962.2-827s1c1
Sequence:CCGGCGAGAGGAGATTGAAGTGGATCTCGAGATCCACTTCAATCTCCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005962.2-557s1c1
Sequence:CCGGCGCCTTTGTTTAGAACGCTTACTCGAGTAAGCGTTCTAAACAAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005962
VALIDATED
MXI1 MISSION shRNA shRNA Plasmid DNA
MAX interactor 1, dimerization protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005962.4-1273s21c1
Sequence:CCGGGAACCCTTCCTGAGCTTTATGCTCGAGCATAAAGCTCAGGAAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005962.4-1455s21c1
Sequence:CCGGGCTCATTTCATGCTCTGCAAACTCGAGTTTGCAGAGCATGAAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-769s21c1
Sequence:CCGGCATGGAGAAGTGGACAATATACTCGAGTATATTGTCCACTTCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-682s21c1
Sequence:CCGGGACAGCATTGGATCAACTATTCTCGAGAATAGTTGATCCAATGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-655s21c1
Sequence:CCGGCCTCAGGAGATGGAACGAATACTCGAGTATTCGTTCCATCTCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-547s21c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-1555s1c1
Sequence:CCGGGCTCATTTCATGCTCTGCAAACTCGAGTTTGCAGAGCATGAAATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-755s1c1
Sequence:CCGGCCTCAGGAGATGGAACGAATACTCGAGTATTCGTTCCATCTCCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-647s1c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005962.2-827s1c1
Sequence:CCGGCGAGAGGAGATTGAAGTGGATCTCGAGATCCACTTCAATCTCCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005962.2-557s1c1
Sequence:CCGGCGCCTTTGTTTAGAACGCTTACTCGAGTAAGCGTTCTAAACAAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005962
VALIDATED
MXI1 MISSION shRNA Lentiviral Transduction Particles
MAX interactor 1, dimerization protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005962.4-1273s21c1
Sequence:CCGGGAACCCTTCCTGAGCTTTATGCTCGAGCATAAAGCTCAGGAAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005962.4-1455s21c1
Sequence:CCGGGCTCATTTCATGCTCTGCAAACTCGAGTTTGCAGAGCATGAAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-769s21c1
Sequence:CCGGCATGGAGAAGTGGACAATATACTCGAGTATATTGTCCACTTCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-682s21c1
Sequence:CCGGGACAGCATTGGATCAACTATTCTCGAGAATAGTTGATCCAATGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-655s21c1
Sequence:CCGGCCTCAGGAGATGGAACGAATACTCGAGTATTCGTTCCATCTCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005962.4-547s21c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-1555s1c1
Sequence:CCGGGCTCATTTCATGCTCTGCAAACTCGAGTTTGCAGAGCATGAAATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-755s1c1
Sequence:CCGGCCTCAGGAGATGGAACGAATACTCGAGTATTCGTTCCATCTCCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005962.2-647s1c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005962.2-827s1c1
Sequence:CCGGCGAGAGGAGATTGAAGTGGATCTCGAGATCCACTTCAATCTCCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005962.2-557s1c1
Sequence:CCGGCGCCTTTGTTTAGAACGCTTACTCGAGTAAGCGTTCTAAACAAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010847
VALIDATED
MXI1 MISSION shRNA Bacterial Glycerol Stock
MAX interactor 1, dimerization protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-867s21c1
Sequence:CCGGTCGGGAGTGACGAGGGTTATTCTCGAGAATAACCCTCGTCACTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-221s1c1
Sequence:CCGGCAGATCTACACACAATGAGTTCTCGAGAACTCATTGTGTGTAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010847.1-341s1c1
Sequence:CCGGGCTCAACAAAGCCAAAGCACACTCGAGTGTGCTTTGGCTTTGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-357s1c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-489s21c1
Sequence:CCGGTGTGTTTAGAACGCTTGAAAGCTCGAGCTTTCAAGCGTTCTAAACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-689s21c1
Sequence:CCGGGAGATGGAGCGGATACGAATGCTCGAGCATTCGTATCCGCTCCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010847.3-1333s21c1
Sequence:CCGGGCAGGATAATCAGGCATTAATCTCGAGATTAATGCCTGATTATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-487s1c1
Sequence:CCGGGAATGGACAGCATTGGATCAACTCGAGTTGATCCAATGCTGTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-549s21c1
Sequence:CCGGCACTCGGTTTGCTCAACAAAGCTCGAGCTTTGTTGAGCAAACCGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-216s1c1
Sequence:CCGGGCCAACAGATCTACACACAATCTCGAGATTGTGTGTAGATCTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010847
VALIDATED
MXI1 MISSION shRNA shRNA Plasmid DNA
MAX interactor 1, dimerization protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-867s21c1
Sequence:CCGGTCGGGAGTGACGAGGGTTATTCTCGAGAATAACCCTCGTCACTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-221s1c1
Sequence:CCGGCAGATCTACACACAATGAGTTCTCGAGAACTCATTGTGTGTAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010847.1-341s1c1
Sequence:CCGGGCTCAACAAAGCCAAAGCACACTCGAGTGTGCTTTGGCTTTGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-357s1c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-489s21c1
Sequence:CCGGTGTGTTTAGAACGCTTGAAAGCTCGAGCTTTCAAGCGTTCTAAACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-689s21c1
Sequence:CCGGGAGATGGAGCGGATACGAATGCTCGAGCATTCGTATCCGCTCCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010847.3-1333s21c1
Sequence:CCGGGCAGGATAATCAGGCATTAATCTCGAGATTAATGCCTGATTATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-487s1c1
Sequence:CCGGGAATGGACAGCATTGGATCAACTCGAGTTGATCCAATGCTGTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-549s21c1
Sequence:CCGGCACTCGGTTTGCTCAACAAAGCTCGAGCTTTGTTGAGCAAACCGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-216s1c1
Sequence:CCGGGCCAACAGATCTACACACAATCTCGAGATTGTGTGTAGATCTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010847
VALIDATED
MXI1 MISSION shRNA Lentiviral Transduction Particles
MAX interactor 1, dimerization protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-867s21c1
Sequence:CCGGTCGGGAGTGACGAGGGTTATTCTCGAGAATAACCCTCGTCACTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-221s1c1
Sequence:CCGGCAGATCTACACACAATGAGTTCTCGAGAACTCATTGTGTGTAGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010847.1-341s1c1
Sequence:CCGGGCTCAACAAAGCCAAAGCACACTCGAGTGTGCTTTGGCTTTGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-357s1c1
Sequence:CCGGGCACACATCAAGAAACTTGAACTCGAGTTCAAGTTTCTTGATGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-489s21c1
Sequence:CCGGTGTGTTTAGAACGCTTGAAAGCTCGAGCTTTCAAGCGTTCTAAACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-689s21c1
Sequence:CCGGGAGATGGAGCGGATACGAATGCTCGAGCATTCGTATCCGCTCCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010847.3-1333s21c1
Sequence:CCGGGCAGGATAATCAGGCATTAATCTCGAGATTAATGCCTGATTATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-487s1c1
Sequence:CCGGGAATGGACAGCATTGGATCAACTCGAGTTGATCCAATGCTGTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010847.3-549s21c1
Sequence:CCGGCACTCGGTTTGCTCAACAAAGCTCGAGCTTTGTTGAGCAAACCGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010847.1-216s1c1
Sequence:CCGGGCCAACAGATCTACACACAATCTCGAGATTGTGTGTAGATCTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)