EMAIL THIS PAGE TO A FRIEND

MXRA5

matrix-remodelling associated 5

35 Gene Product Result for
UniProtKB ID: Q9NR99, Q6P1M7, Q9Y3Y8
Gene ID:
Human(25878) Summary: This gene encodes one of the matrix-remodelling associated proteins. This protein contains 7 leucine-rich repeats and 12 immunoglobulin-like C2-type domains related to perlecan. This gene has a pseudogene on chromosome Y. [provided by RefSeq, Mar 2010]
Zebrafish(100331447) matrix-remodelling associated 5
chicken(418657) matrix-remodelling associated 5
cow(786844) matrix-remodelling associated 5
Horse(100063681) matrix-remodelling associated 5
domestic cat(101080687) matrix-remodelling associated 5
dog(491721) matrix-remodelling associated 5
sheep(101116543) matrix-remodelling associated 5
naked mole-rat(101699686) matrix-remodelling associated 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015419 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127481 MISSION® esiRNA esiRNA human MXRA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015419 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119628 predicted 1832
2 SASI_Hs01_00119629 predicted 4014
3 SASI_Hs02_00347799 predicted 2004
4 SASI_Hs02_00347800 predicted 1165
5 SASI_Hs01_00119631 predicted 397
6 SASI_Hs02_00347801 predicted 3326
7 SASI_Hs01_00119632 predicted 1935
8 SASI_Hs01_00119633 predicted 3455
9 SASI_Hs02_00347802 predicted 477
10 SASI_Hs01_00119634 predicted 882
11 SASI_Hs01_00119630 predicted 7921
12 SASI_Hs01_00119635 predicted 3120
13 SASI_Hs01_00119636 predicted 8464
14 SASI_Hs01_00119637 predicted 3026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015419
VALIDATED
MXRA5 MISSION shRNA Bacterial Glycerol Stock
matrix-remodelling associated 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015419.1-9333s1c1
Sequence:CCGGGCGATATTAGATTTCCTTGTACTCGAGTACAAGGAAATCTAATATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015419.1-6667s1c1
Sequence:CCGGGCTCGAAATAAGGTTGGTGATCTCGAGATCACCAACCTTATTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-659s1c1
Sequence:CCGGCCTGCGATTGTGAGATGAGATCTCGAGATCTCATCTCACAATCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-3864s1c1
Sequence:CCGGCCCTTATGATTCCTTAGATTACTCGAGTAATCTAAGGAATCATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-3863s1c1
Sequence:CCGGGCCCTTATGATTCCTTAGATTCTCGAGAATCTAAGGAATCATAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015419
VALIDATED
MXRA5 MISSION shRNA shRNA Plasmid DNA
matrix-remodelling associated 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015419.1-9333s1c1
Sequence:CCGGGCGATATTAGATTTCCTTGTACTCGAGTACAAGGAAATCTAATATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015419.1-6667s1c1
Sequence:CCGGGCTCGAAATAAGGTTGGTGATCTCGAGATCACCAACCTTATTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-659s1c1
Sequence:CCGGCCTGCGATTGTGAGATGAGATCTCGAGATCTCATCTCACAATCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-3864s1c1
Sequence:CCGGCCCTTATGATTCCTTAGATTACTCGAGTAATCTAAGGAATCATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-3863s1c1
Sequence:CCGGGCCCTTATGATTCCTTAGATTCTCGAGAATCTAAGGAATCATAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015419
VALIDATED
MXRA5 MISSION shRNA Lentiviral Transduction Particles
matrix-remodelling associated 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015419.1-9333s1c1
Sequence:CCGGGCGATATTAGATTTCCTTGTACTCGAGTACAAGGAAATCTAATATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015419.1-6667s1c1
Sequence:CCGGGCTCGAAATAAGGTTGGTGATCTCGAGATCACCAACCTTATTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-659s1c1
Sequence:CCGGCCTGCGATTGTGAGATGAGATCTCGAGATCTCATCTCACAATCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-3864s1c1
Sequence:CCGGCCCTTATGATTCCTTAGATTACTCGAGTAATCTAAGGAATCATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015419.1-3863s1c1
Sequence:CCGGGCCCTTATGATTCCTTAGATTCTCGAGAATCTAAGGAATCATAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)