EMAIL THIS PAGE TO A FRIEND

MXRA8

matrix-remodelling associated 8

57 Gene Product Result for
UniProtKB ID: Q9BRK3, Q5TA39, Q96KC3
Gene ID:
Mouse(74761) matrix-remodelling associated 8
Rat(313770) matrix-remodelling associated 8
sheep(101103998) matrix-remodelling associated 8
domestic guinea pig(100728468) matrix-remodelling associated 8
naked mole-rat(101713310) matrix-remodelling associated 8
chicken(395347) matrix-remodelling associated 8
dog(489592) matrix-remodelling associated 8
cow(522392) matrix-remodelling associated 8
domestic cat(101085030) matrix-remodelling associated 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032348 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053681 MISSION® esiRNA esiRNA targeting mouse Mxra8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032348 Rosetta Predictions human pricing
NM_001007002 Rosetta Predictions rat pricing
NM_024263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188471 predicted 1233
2 SASI_Hs01_00188472 predicted 773
3 SASI_Hs02_00359737 predicted 1236
4 SASI_Hs01_00188473 predicted 781
5 SASI_Hs01_00188474 predicted 1179
6 SASI_Hs01_00188475 predicted 1301
7 SASI_Hs01_00188476 predicted 1209
8 SASI_Hs01_00188477 predicted 1307
9 SASI_Hs01_00188478 predicted 880
10 SASI_Hs01_00188480 predicted 1236
11 SASI_Hs01_00188479 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118233 predicted 739
2 SASI_Rn01_00118234 predicted 1603
3 SASI_Rn02_00198589 predicted 1480
4 SASI_Rn02_00198590 predicted 988
5 SASI_Rn02_00198591 predicted 813
6 SASI_Rn01_00118238 predicted 511
7 SASI_Rn01_00118239 predicted 1242
8 SASI_Rn01_00118240 predicted 567
9 SASI_Rn01_00118241 predicted 1016
10 SASI_Rn01_00118242 predicted 959
11 SASI_Rn01_00118235 predicted 861
12 SASI_Rn01_00118236 predicted 1153
13 SASI_Rn01_00118237 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327663 predicted 1744
2 SASI_Mm02_00327664 predicted 1753
3 SASI_Mm01_00140988 predicted 1265
4 SASI_Mm01_00140989 predicted 1322
5 SASI_Mm02_00327665 predicted 1760
6 SASI_Mm01_00140991 predicted 1614
7 SASI_Mm01_00140992 predicted 1323
8 SASI_Mm01_00140994 predicted 1641
9 SASI_Mm01_00140996 predicted 888
10 SASI_Mm01_00140997 predicted 1309
11 SASI_Mm01_00140990 predicted 1522
12 SASI_Mm01_00140993 predicted 836
13 SASI_Mm01_00140995 predicted 1549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024263
VALIDATED
MXRA8 MISSION shRNA Bacterial Glycerol Stock
matrix-remodelling associated 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024263.4-951s21c1
Sequence:CCGGAGCTGATGAGGGCATCTATTCCTCGAGGAATAGATGCCCTCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024263.4-1846s21c1
Sequence:CCGGACTCCCTAGCCACCAGTTAAACTCGAGTTTAACTGGTGGCTAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-1234s21c1
Sequence:CCGGGTAGTCCTGGCTACACGATATCTCGAGATATCGTGTAGCCAGGACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-733s21c1
Sequence:CCGGGTGTGGACTGACCGCCATTTACTCGAGTAAATGGCGGTCAGTCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024263.3-1795s1c1
Sequence:CCGGCCAGTTAAACACATTAGCCATCTCGAGATGGCTAATGTGTTTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024263.3-1392s1c1
Sequence:CCGGCAGGAAGGAGTACTGCAAATACTCGAGTATTTGCAGTACTCCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-416s21c1
Sequence:CCGGGCCGACTTGTGGATATGTATTCTCGAGAATACATATCCACAAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024263.3-1687s1c1
Sequence:CCGGCACAACAAAGATCCCTTGTTACTCGAGTAACAAGGGATCTTTGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024263
VALIDATED
MXRA8 MISSION shRNA shRNA Plasmid DNA
matrix-remodelling associated 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024263.4-951s21c1
Sequence:CCGGAGCTGATGAGGGCATCTATTCCTCGAGGAATAGATGCCCTCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024263.4-1846s21c1
Sequence:CCGGACTCCCTAGCCACCAGTTAAACTCGAGTTTAACTGGTGGCTAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-1234s21c1
Sequence:CCGGGTAGTCCTGGCTACACGATATCTCGAGATATCGTGTAGCCAGGACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-733s21c1
Sequence:CCGGGTGTGGACTGACCGCCATTTACTCGAGTAAATGGCGGTCAGTCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024263.3-1795s1c1
Sequence:CCGGCCAGTTAAACACATTAGCCATCTCGAGATGGCTAATGTGTTTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024263.3-1392s1c1
Sequence:CCGGCAGGAAGGAGTACTGCAAATACTCGAGTATTTGCAGTACTCCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-416s21c1
Sequence:CCGGGCCGACTTGTGGATATGTATTCTCGAGAATACATATCCACAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024263.3-1687s1c1
Sequence:CCGGCACAACAAAGATCCCTTGTTACTCGAGTAACAAGGGATCTTTGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024263
VALIDATED
MXRA8 MISSION shRNA Lentiviral Transduction Particles
matrix-remodelling associated 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024263.4-951s21c1
Sequence:CCGGAGCTGATGAGGGCATCTATTCCTCGAGGAATAGATGCCCTCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024263.4-1846s21c1
Sequence:CCGGACTCCCTAGCCACCAGTTAAACTCGAGTTTAACTGGTGGCTAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-1234s21c1
Sequence:CCGGGTAGTCCTGGCTACACGATATCTCGAGATATCGTGTAGCCAGGACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-733s21c1
Sequence:CCGGGTGTGGACTGACCGCCATTTACTCGAGTAAATGGCGGTCAGTCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024263.3-1795s1c1
Sequence:CCGGCCAGTTAAACACATTAGCCATCTCGAGATGGCTAATGTGTTTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024263.3-1392s1c1
Sequence:CCGGCAGGAAGGAGTACTGCAAATACTCGAGTATTTGCAGTACTCCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024263.4-416s21c1
Sequence:CCGGGCCGACTTGTGGATATGTATTCTCGAGAATACATATCCACAAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024263.3-1687s1c1
Sequence:CCGGCACAACAAAGATCCCTTGTTACTCGAGTAACAAGGGATCTTTGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032348
MXRA8 MISSION shRNA Bacterial Glycerol Stock
matrix-remodelling associated 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1177s1c1
Sequence:CCGGGAAGGATGTTAACTTGGCGGACTCGAGTCCGCCAAGTTAACATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1181s1c1
Sequence:CCGGGATGTTAACTTGGCGGAGTTCCTCGAGGAACTCCGCCAAGTTAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1153s1c1
Sequence:CCGGCCAGAAGTCGGGAAAGTCAAACTCGAGTTTGACTTTCCCGACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1000s1c1
Sequence:CCGGCCACAACGTCATCAATGTCATCTCGAGATGACATTGATGACGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1241s1c1
Sequence:CCGGGACATCCAGCTAGATTACAAACTCGAGTTTGTAATCTAGCTGGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1312s1c1
Sequence:CCGGCAAGTACATCGACCTAGACAACTCGAGTTGTCTAGGTCGATGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1236s1c1
Sequence:CCGGGTGAGGACATCCAGCTAGATTCTCGAGAATCTAGCTGGATGTCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032348.2-1795s1c1
Sequence:CCGGCCATCAGAACTTGGCAGCCTTCTCGAGAAGGCTGCCAAGTTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-999s1c1
Sequence:CCGGGCCACAACGTCATCAATGTCACTCGAGTGACATTGATGACGTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032348
MXRA8 MISSION shRNA shRNA Plasmid DNA
matrix-remodelling associated 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1177s1c1
Sequence:CCGGGAAGGATGTTAACTTGGCGGACTCGAGTCCGCCAAGTTAACATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1181s1c1
Sequence:CCGGGATGTTAACTTGGCGGAGTTCCTCGAGGAACTCCGCCAAGTTAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1153s1c1
Sequence:CCGGCCAGAAGTCGGGAAAGTCAAACTCGAGTTTGACTTTCCCGACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1000s1c1
Sequence:CCGGCCACAACGTCATCAATGTCATCTCGAGATGACATTGATGACGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1241s1c1
Sequence:CCGGGACATCCAGCTAGATTACAAACTCGAGTTTGTAATCTAGCTGGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1312s1c1
Sequence:CCGGCAAGTACATCGACCTAGACAACTCGAGTTGTCTAGGTCGATGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1236s1c1
Sequence:CCGGGTGAGGACATCCAGCTAGATTCTCGAGAATCTAGCTGGATGTCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032348.2-1795s1c1
Sequence:CCGGCCATCAGAACTTGGCAGCCTTCTCGAGAAGGCTGCCAAGTTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-999s1c1
Sequence:CCGGGCCACAACGTCATCAATGTCACTCGAGTGACATTGATGACGTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032348
MXRA8 MISSION shRNA Lentiviral Transduction Particles
matrix-remodelling associated 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1177s1c1
Sequence:CCGGGAAGGATGTTAACTTGGCGGACTCGAGTCCGCCAAGTTAACATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1181s1c1
Sequence:CCGGGATGTTAACTTGGCGGAGTTCCTCGAGGAACTCCGCCAAGTTAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1153s1c1
Sequence:CCGGCCAGAAGTCGGGAAAGTCAAACTCGAGTTTGACTTTCCCGACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1000s1c1
Sequence:CCGGCCACAACGTCATCAATGTCATCTCGAGATGACATTGATGACGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1241s1c1
Sequence:CCGGGACATCCAGCTAGATTACAAACTCGAGTTTGTAATCTAGCTGGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1312s1c1
Sequence:CCGGCAAGTACATCGACCTAGACAACTCGAGTTGTCTAGGTCGATGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-1236s1c1
Sequence:CCGGGTGAGGACATCCAGCTAGATTCTCGAGAATCTAGCTGGATGTCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032348.2-1795s1c1
Sequence:CCGGCCATCAGAACTTGGCAGCCTTCTCGAGAAGGCTGCCAAGTTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032348.2-999s1c1
Sequence:CCGGGCCACAACGTCATCAATGTCACTCGAGTGACATTGATGACGTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)