EMAIL THIS PAGE TO A FRIEND

MYADML2

myeloid-associated differentiation marker-like 2

93 Gene Product Result for
UniProtKB ID: A6NDP7
Gene ID:
Mouse(68515) myeloid-associated differentiation marker-like 2
Rat(303744) myeloid-associated differentiation marker-like 2
chicken(427806) myeloid-associated differentiation marker-like 2
cow(617922) myeloid-associated differentiation marker-like 2
domestic cat(101100931) myeloid-associated differentiation marker-like 2
dog(483373) myeloid-associated differentiation marker-like 2
domestic guinea pig(100735345) myeloid-associated differentiation marker-like 2
naked mole-rat(101721313) myeloid-associated differentiation marker-like 2
sheep(101112912) myeloid-associated differentiation marker-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145113 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_171855 Rosetta Predictions human pricing
XR_041346 Rosetta Predictions human pricing
XR_041347 Rosetta Predictions human pricing
XR_041348 Rosetta Predictions human pricing
NM_001128185 Rosetta Predictions rat pricing
XM_126634 Rosetta Predictions mouse pricing
XM_903146 Rosetta Predictions mouse pricing
XM_917346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_171855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264725 predicted 1699
2 SASI_Hs01_00264726 predicted 1660
3 SASI_Hs01_00264727 predicted 435
4 SASI_Hs01_00264728 predicted 1450
5 SASI_Hs01_00264729 predicted 1090
6 SASI_Hs01_00264730 predicted 1334
7 SASI_Hs01_00264731 predicted 944
8 SASI_Hs01_00264732 predicted 445
9 SASI_Hs01_00264733 predicted 1574
10 SASI_Hs01_00264734 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526566 predicted 1662
2 SASI_Hs02_00526567 predicted 441
3 SASI_Hs02_00526568 predicted 1441
4 SASI_Hs02_00526569 predicted 2103
5 SASI_Hs02_00526570 predicted 1087
6 SASI_Hs02_00526571 predicted 2093
7 SASI_Hs02_00526572 predicted 2092
8 SASI_Hs02_00526573 predicted 2542
9 SASI_Hs02_00526574 predicted 947
10 SASI_Hs02_00526575 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526576 predicted 440
2 SASI_Hs02_00526577 predicted 1329
3 SASI_Hs02_00526578 predicted 2098
4 SASI_Hs02_00526579 predicted 1090
5 SASI_Hs02_00526580 predicted 2091
6 SASI_Hs02_00526581 predicted 1334
7 SASI_Hs02_00526582 predicted 2088
8 SASI_Hs02_00526583 predicted 2543
9 SASI_Hs02_00526584 predicted 950
10 SASI_Hs02_00526585 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526586 predicted 1658
2 SASI_Hs02_00526587 predicted 440
3 SASI_Hs02_00526588 predicted 1442
4 SASI_Hs02_00526589 predicted 2106
5 SASI_Hs02_00526590 predicted 1088
6 SASI_Hs02_00526591 predicted 2097
7 SASI_Hs02_00526592 predicted 2088
8 SASI_Hs02_00526593 predicted 2538
9 SASI_Hs02_00526594 predicted 1337
10 SASI_Hs02_00526595 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255040 predicted 1073
2 SASI_Rn02_00255041 predicted 883
3 SASI_Rn02_00255042 predicted 620
4 SASI_Rn02_00255043 predicted 965
5 SASI_Rn02_00255044 predicted 562
6 SASI_Rn02_00255045 predicted 1341
7 SASI_Rn02_00255046 predicted 1311
8 SASI_Rn02_00255047 predicted 504
9 SASI_Rn02_00255048 predicted 1398
10 SASI_Rn02_00255049 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242264 predicted 1148
2 SASI_Mm01_00242265 predicted 1154
3 SASI_Mm01_00242262 predicted 1571
4 SASI_Mm01_00242266 predicted 1650
5 SASI_Mm01_00242267 predicted 432
6 SASI_Mm01_00242263 predicted 1312
7 SASI_Mm01_00242268 predicted 1148
8 SASI_Mm02_00424150 predicted 844
9 SASI_Mm02_00424151 predicted 1004
10 SASI_Mm02_00424152 predicted 1005
11 SASI_Mm01_00242259 predicted 1544
12 SASI_Mm01_00242260 predicted 1576
13 SASI_Mm01_00242261 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262611 predicted 783
2 SASI_Mm01_00262612 predicted 537
3 SASI_Mm01_00262613 predicted 432
4 SASI_Mm01_00262614 predicted 533
5 SASI_Mm01_00262615 predicted 1024
6 SASI_Mm01_00262616 predicted 864
7 SASI_Mm01_00262617 predicted 817
8 SASI_Mm01_00262618 predicted 426
9 SASI_Mm01_00262619 predicted 894
10 SASI_Mm01_00262620 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441104 predicted 1152
2 SASI_Mm02_00441105 predicted 1152
3 SASI_Mm02_00441106 predicted 1574
4 SASI_Mm02_00441107 predicted 1651
5 SASI_Mm02_00441108 predicted 432
6 SASI_Mm02_00441109 predicted 1319
7 SASI_Mm02_00441110 predicted 1149
8 SASI_Mm02_00441111 predicted 841
9 SASI_Mm02_00441112 predicted 1001
10 SASI_Mm02_00441113 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026751
MYADML2 MISSION shRNA Bacterial Glycerol Stock
myeloid-associated differentiation marker-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026751.1-1483s21c1
Sequence:CCGGTCAGTCTCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGAGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1157s21c1
Sequence:CCGGGCCAATTGGTGGTAGCTATTTCTCGAGAAATAGCTACCACCAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-790s21c1
Sequence:CCGGGGTCAGGTAGCCAGCTATATGCTCGAGCATATAGCTGGCTACCTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1202s21c1
Sequence:CCGGACATTGTTGACCTCGCTTATTCTCGAGAATAAGCGAGGTCAACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1013s21c1
Sequence:CCGGACCGCCTAGTGATAGTGTATACTCGAGTATACACTATCACTAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026751
MYADML2 MISSION shRNA shRNA Plasmid DNA
myeloid-associated differentiation marker-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026751.1-1483s21c1
Sequence:CCGGTCAGTCTCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGAGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1157s21c1
Sequence:CCGGGCCAATTGGTGGTAGCTATTTCTCGAGAAATAGCTACCACCAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-790s21c1
Sequence:CCGGGGTCAGGTAGCCAGCTATATGCTCGAGCATATAGCTGGCTACCTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1202s21c1
Sequence:CCGGACATTGTTGACCTCGCTTATTCTCGAGAATAAGCGAGGTCAACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1013s21c1
Sequence:CCGGACCGCCTAGTGATAGTGTATACTCGAGTATACACTATCACTAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026751
MYADML2 MISSION shRNA Lentiviral Transduction Particles
myeloid-associated differentiation marker-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026751.1-1483s21c1
Sequence:CCGGTCAGTCTCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGAGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1157s21c1
Sequence:CCGGGCCAATTGGTGGTAGCTATTTCTCGAGAAATAGCTACCACCAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-790s21c1
Sequence:CCGGGGTCAGGTAGCCAGCTATATGCTCGAGCATATAGCTGGCTACCTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1202s21c1
Sequence:CCGGACATTGTTGACCTCGCTTATTCTCGAGAATAAGCGAGGTCAACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026751.1-1013s21c1
Sequence:CCGGACCGCCTAGTGATAGTGTATACTCGAGTATACACTATCACTAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145113
MYADML2 MISSION shRNA Bacterial Glycerol Stock
myeloid-associated differentiation marker-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145113.2-1196s21c1
Sequence:CCGGGCCATCTTCACCTACGTCAACCTCGAGGTTGACGTAGGTGAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1525s21c1
Sequence:CCGGCTCACTCTCTCTCACCATTTCCTCGAGGAAATGGTGAGAGAGAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145113.2-815s21c1
Sequence:CCGGGGCCAGGTGAGCAGCTATATGCTCGAGCATATAGCTGCTCACCTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1339s21c1
Sequence:CCGGGAAACTCAGGTGAACCAAAGTCTCGAGACTTTGGTTCACCTGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1569s21c1
Sequence:CCGGTGGTCACTGGAACATCATAAGCTCGAGCTTATGATGTTCCAGTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145113
MYADML2 MISSION shRNA shRNA Plasmid DNA
myeloid-associated differentiation marker-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145113.2-1196s21c1
Sequence:CCGGGCCATCTTCACCTACGTCAACCTCGAGGTTGACGTAGGTGAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1525s21c1
Sequence:CCGGCTCACTCTCTCTCACCATTTCCTCGAGGAAATGGTGAGAGAGAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145113.2-815s21c1
Sequence:CCGGGGCCAGGTGAGCAGCTATATGCTCGAGCATATAGCTGCTCACCTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1339s21c1
Sequence:CCGGGAAACTCAGGTGAACCAAAGTCTCGAGACTTTGGTTCACCTGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1569s21c1
Sequence:CCGGTGGTCACTGGAACATCATAAGCTCGAGCTTATGATGTTCCAGTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145113
MYADML2 MISSION shRNA Lentiviral Transduction Particles
myeloid-associated differentiation marker-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145113.2-1196s21c1
Sequence:CCGGGCCATCTTCACCTACGTCAACCTCGAGGTTGACGTAGGTGAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1525s21c1
Sequence:CCGGCTCACTCTCTCTCACCATTTCCTCGAGGAAATGGTGAGAGAGAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145113.2-815s21c1
Sequence:CCGGGGCCAGGTGAGCAGCTATATGCTCGAGCATATAGCTGCTCACCTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1339s21c1
Sequence:CCGGGAAACTCAGGTGAACCAAAGTCTCGAGACTTTGGTTCACCTGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145113.2-1569s21c1
Sequence:CCGGTGGTCACTGGAACATCATAAGCTCGAGCTTATGATGTTCCAGTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)