EMAIL THIS PAGE TO A FRIEND

MYADML

myeloid-associated differentiation marker-like (pseudogene)

22 Gene Product Result for
Species: Human MYADML(151325)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207329 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207329 Rosetta Predictions human pricing
NR_003143 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064580 predicted 983
2 SASI_Hs01_00064581 predicted 877
3 SASI_Hs01_00064582 predicted 976
4 SASI_Hs01_00064583 predicted 980
5 SASI_Hs01_00064584 predicted 741
6 SASI_Hs01_00064585 predicted 650
7 SASI_Hs01_00064586 predicted 752
8 SASI_Hs01_00064587 predicted 689
9 SASI_Hs01_00064588 predicted 641
10 SASI_Hs01_00064589 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378462 predicted 397
2 SASI_Hs02_00378463 predicted 408
3 SASI_Hs02_00378464 predicted 981
4 SASI_Hs02_00378465 predicted 876
5 SASI_Hs02_00378466 predicted 976
6 SASI_Hs02_00378467 predicted 973
7 SASI_Hs02_00378468 predicted 275
8 SASI_Hs02_00378469 predicted 221
9 SASI_Hs02_00378470 predicted 226
10 SASI_Hs02_00378471 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207329
MYADML MISSION shRNA Bacterial Glycerol Stock
myeloid-associated differentiation marker-like (pseudogene)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207329.1-1479s1c1
Sequence:CCGGCCCGACCATCTTCTCCTATTTCTCGAGAAATAGGAGAAGATGGTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-647s1c1
Sequence:CCGGCTTATGCCACCGAAGTAACCTCTCGAGAGGTTACTTCGGTGGCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-752s1c1
Sequence:CCGGGCCTCATCTTCGTGTTCATCACTCGAGTGATGAACACGAAGATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-987s1c1
Sequence:CCGGCAACGAGAAGTATGGTGTCCACTCGAGTGGACACCATACTTCTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-975s1c1
Sequence:CCGGCCTCTACCAGTTCAACGAGAACTCGAGTTCTCGTTGAACTGGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207329.1-1312s1c1
Sequence:CCGGCCCAGTTCTCTGATGTATGTTCTCGAGAACATACATCAGAGAACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-754s1c1
Sequence:CCGGCTCATCTTCGTGTTCATCAATCTCGAGATTGATGAACACGAAGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-982s1c1
Sequence:CCGGCAGTTCAACGAGAAGTATGGTCTCGAGACCATACTTCTCGTTGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-984s1c1
Sequence:CCGGGTTCAACGAGAAGTATGGTGTCTCGAGACACCATACTTCTCGTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-753s1c1
Sequence:CCGGCCTCATCTTCGTGTTCATCAACTCGAGTTGATGAACACGAAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207329
MYADML MISSION shRNA shRNA Plasmid DNA
myeloid-associated differentiation marker-like (pseudogene)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207329.1-1479s1c1
Sequence:CCGGCCCGACCATCTTCTCCTATTTCTCGAGAAATAGGAGAAGATGGTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-647s1c1
Sequence:CCGGCTTATGCCACCGAAGTAACCTCTCGAGAGGTTACTTCGGTGGCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-752s1c1
Sequence:CCGGGCCTCATCTTCGTGTTCATCACTCGAGTGATGAACACGAAGATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-987s1c1
Sequence:CCGGCAACGAGAAGTATGGTGTCCACTCGAGTGGACACCATACTTCTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-975s1c1
Sequence:CCGGCCTCTACCAGTTCAACGAGAACTCGAGTTCTCGTTGAACTGGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207329.1-1312s1c1
Sequence:CCGGCCCAGTTCTCTGATGTATGTTCTCGAGAACATACATCAGAGAACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-754s1c1
Sequence:CCGGCTCATCTTCGTGTTCATCAATCTCGAGATTGATGAACACGAAGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-982s1c1
Sequence:CCGGCAGTTCAACGAGAAGTATGGTCTCGAGACCATACTTCTCGTTGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-984s1c1
Sequence:CCGGGTTCAACGAGAAGTATGGTGTCTCGAGACACCATACTTCTCGTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-753s1c1
Sequence:CCGGCCTCATCTTCGTGTTCATCAACTCGAGTTGATGAACACGAAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207329
MYADML MISSION shRNA Lentiviral Transduction Particles
myeloid-associated differentiation marker-like (pseudogene)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207329.1-1479s1c1
Sequence:CCGGCCCGACCATCTTCTCCTATTTCTCGAGAAATAGGAGAAGATGGTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-647s1c1
Sequence:CCGGCTTATGCCACCGAAGTAACCTCTCGAGAGGTTACTTCGGTGGCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-752s1c1
Sequence:CCGGGCCTCATCTTCGTGTTCATCACTCGAGTGATGAACACGAAGATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-987s1c1
Sequence:CCGGCAACGAGAAGTATGGTGTCCACTCGAGTGGACACCATACTTCTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-975s1c1
Sequence:CCGGCCTCTACCAGTTCAACGAGAACTCGAGTTCTCGTTGAACTGGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207329.1-1312s1c1
Sequence:CCGGCCCAGTTCTCTGATGTATGTTCTCGAGAACATACATCAGAGAACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-754s1c1
Sequence:CCGGCTCATCTTCGTGTTCATCAATCTCGAGATTGATGAACACGAAGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-982s1c1
Sequence:CCGGCAGTTCAACGAGAAGTATGGTCTCGAGACCATACTTCTCGTTGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207329.1-984s1c1
Sequence:CCGGGTTCAACGAGAAGTATGGTGTCTCGAGACACCATACTTCTCGTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207329.1-753s1c1
Sequence:CCGGCCTCATCTTCGTGTTCATCAACTCGAGTTGATGAACACGAAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)