EMAIL THIS PAGE TO A FRIEND

MYB

v-myb avian myeloblastosis viral oncogene homolog

225 Gene Product Result for
Synonyms: Cmyb c-myb c-myb_CDS efg
Gene ID:
Human(4602) Summary: This gene encodes a transcription factor that is a member of the MYB family of transcription factor genes. The protein contains three domains, an N-terminal DNA-binding domain, a central transcriptional activation domain and a C-terminal domain involved in transcriptional repression. This protein plays an essential role in the regulation of hematopoiesis and may play a role in tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Mouse(17863) myeloblastosis oncogene
Zebrafish(100005189) myeloblastosis oncogene
cow(317776) v-myb myeloblastosis viral oncogene homolog (avian)
Horse(100073162) v-myb myeloblastosis viral oncogene homolog (avian)
domestic cat(101081140) v-myb myeloblastosis viral oncogene homolog (avian)
dog(483995) v-myb myeloblastosis viral oncogene homolog (avian)
chicken(396244) v-myb myeloblastosis viral oncogene homolog
fruit fly(32543) Myb oncogene-like
sheep(101109886) v-myb myeloblastosis viral oncogene homolog (avian)
naked mole-rat(101718117) v-myb myeloblastosis viral oncogene homolog (avian)
Domestic Rabbit(100347664) v-myb myeloblastosis viral oncogene homolog (avian)
domestic guinea pig(100719682) v-myb myeloblastosis viral oncogene homolog (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501586 Anti-MYB antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, rat, mouse
ELISA, western blot pricing
SAB1406152 Anti-MYB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1409332 Anti-MYB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV38611 Anti-MyB antibody produced in rabbit affinity isolated antibody rabbit, canine, rat, guinea pig, bovine, horse, human, mouse
immunohistochemistry, western blot pricing
SAB4501936 Anti-MYB antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501937 Anti-MYB antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB1305657 ANTI-MYB SUMOYLATION SITE antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
SAB2500663 Anti-MYB/C-MYB antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, canine, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503942 Anti-phospho-MYB (pSer12) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4200617 Monoclonal Anti-Myb antibody from mouse clone MB-8, purified immunoglobulin human, mouse
flow cytometry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005375 Rosetta Predictions human pricing
NM_010848 Rosetta Predictions mouse pricing
NM_033597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127047 predicted 1331
2 SASI_Hs01_00127048 predicted 1077
3 SASI_Hs01_00127049 predicted 1438
4 SASI_Hs01_00127050 predicted 2158
5 SASI_Hs01_00127051 predicted 1466
6 SASI_Hs01_00127052 predicted 1347
7 SASI_Hs02_00339480 predicted 1948
8 SASI_Hs02_00339481 predicted 1780
9 SASI_Hs02_00339482 predicted 1354
10 SASI_Hs02_00339483 predicted 449
11 SASI_Hs01_00127045 predicted 1032
12 SASI_Hs01_00127046 predicted 995
13 SASI_Hs01_00127053 predicted 970
14 SASI_Hs01_00127054 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319497 predicted 450
2 SASI_Mm02_00319498 predicted 1458
3 SASI_Mm02_00319499 predicted 976
4 SASI_Mm02_00319500 predicted 997
5 SASI_Mm02_00319501 predicted 2011
6 SASI_Mm02_00319502 predicted 1865
7 SASI_Mm02_00319503 predicted 1626
8 SASI_Mm02_00319504 predicted 1851
9 SASI_Mm02_00319505 predicted 987
10 SASI_Mm02_00319506 predicted 665
11 SASI_Mm01_00121741 predicted 2116
12 SASI_Mm01_00121742 predicted 791
13 SASI_Mm01_00121743 predicted 2140
14 SASI_Mm01_00121744 predicted 2120
15 SASI_Mm01_00121745 predicted 784
16 SASI_Mm01_00121746 predicted 836
17 SASI_Mm01_00121747 predicted 784
18 SASI_Mm01_00121748 predicted 2123
19 SASI_Mm01_00121749 predicted 2112
20 SASI_Mm01_00121750 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183971 predicted 2670
2 SASI_Mm01_00183972 predicted 968
3 SASI_Mm01_00183973 predicted 2685
4 SASI_Mm01_00183974 predicted 2666
5 SASI_Mm01_00183975 predicted 973
6 SASI_Mm01_00183976 predicted 1018
7 SASI_Mm01_00183977 predicted 963
8 SASI_Mm01_00183978 predicted 2666
9 SASI_Mm01_00183979 predicted 2662
10 SASI_Mm01_00183980 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010848
MYB MISSION shRNA Bacterial Glycerol Stock
v-myb avian myeloblastosis viral oncogene homolog
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010848.3-2640s21c1
Sequence:CCGGGTTAGCTAAATCCCAAGTAATCTCGAGATTACTTGGGATTTAGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010848.3-1052s21c1
Sequence:CCGGTGTCGCATTGCATGTTAATATCTCGAGATATTAACATGCAATGCGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1164s1c1
Sequence:CCGGGCTCCTGATGTCAACAGAGAACTCGAGTTCTCTGTTGACATCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1595s1c1
Sequence:CCGGCCATCTTTAGAACTCCAGCTACTCGAGTAGCTGGAGTTCTAAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-984s1c1
Sequence:CCGGCAACAGCGAATATCCCTATTACTCGAGTAATAGGGATATTCGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1848s1c1
Sequence:CCGGGCCAACTGAGAAATCGGGAAACTCGAGTTTCCCGATTTCTCAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-544s1c1
Sequence:CCGGCCCTGGACCAAAGAAGAAGATCTCGAGATCTTCTTCTTTGGTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010848
MYB MISSION shRNA shRNA Plasmid DNA
v-myb avian myeloblastosis viral oncogene homolog
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010848.3-2640s21c1
Sequence:CCGGGTTAGCTAAATCCCAAGTAATCTCGAGATTACTTGGGATTTAGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010848.3-1052s21c1
Sequence:CCGGTGTCGCATTGCATGTTAATATCTCGAGATATTAACATGCAATGCGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1164s1c1
Sequence:CCGGGCTCCTGATGTCAACAGAGAACTCGAGTTCTCTGTTGACATCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1595s1c1
Sequence:CCGGCCATCTTTAGAACTCCAGCTACTCGAGTAGCTGGAGTTCTAAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-984s1c1
Sequence:CCGGCAACAGCGAATATCCCTATTACTCGAGTAATAGGGATATTCGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1848s1c1
Sequence:CCGGGCCAACTGAGAAATCGGGAAACTCGAGTTTCCCGATTTCTCAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-544s1c1
Sequence:CCGGCCCTGGACCAAAGAAGAAGATCTCGAGATCTTCTTCTTTGGTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010848
MYB MISSION shRNA Lentiviral Transduction Particles
v-myb avian myeloblastosis viral oncogene homolog
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010848.3-2640s21c1
Sequence:CCGGGTTAGCTAAATCCCAAGTAATCTCGAGATTACTTGGGATTTAGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010848.3-1052s21c1
Sequence:CCGGTGTCGCATTGCATGTTAATATCTCGAGATATTAACATGCAATGCGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1164s1c1
Sequence:CCGGGCTCCTGATGTCAACAGAGAACTCGAGTTCTCTGTTGACATCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1595s1c1
Sequence:CCGGCCATCTTTAGAACTCCAGCTACTCGAGTAGCTGGAGTTCTAAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-984s1c1
Sequence:CCGGCAACAGCGAATATCCCTATTACTCGAGTAATAGGGATATTCGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-1848s1c1
Sequence:CCGGGCCAACTGAGAAATCGGGAAACTCGAGTTTCCCGATTTCTCAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010848.2-544s1c1
Sequence:CCGGCCCTGGACCAAAGAAGAAGATCTCGAGATCTTCTTCTTTGGTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005375
VALIDATED
MYB MISSION shRNA Bacterial Glycerol Stock
v-myb avian myeloblastosis viral oncogene homolog
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-2596s21c1
Sequence:CCGGCCAGATTGTAAATGCTCATTTCTCGAGAAATGAGCATTTACAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-737s21c1
Sequence:CCGGGCTATCAAGAACCACTGGAATCTCGAGATTCCAGTGGTTCTTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-1099s21c1
Sequence:CCGGGCTCCTAATGTCAACCGAGAACTCGAGTTCTCGGTTGACATTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-927s21c1
Sequence:CCGGACTATTCCTATTACCACATTTCTCGAGAAATGTGGTAATAGGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005375.2-1670s21c1
Sequence:CCGGCCCTCTCATCTAGTAGAAGATCTCGAGATCTTCTACTAGATGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005375.x-3045s1c1
Sequence:CCGGTAAGTGTATGGTCTCAGAACTCTCGAGAGTTCTGAGACCATACACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.x-279s1c1
Sequence:CCGGAACAGAATGGAACAGATGACCTCGAGGTCATCTGTTCCATTCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.1-1013s1c1
Sequence:CCGGGCTCCTAATGTCAACCGAGAACTCGAGTTCTCGGTTGACATTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005375.1-1845s1c1
Sequence:CCGGGCATCAGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.1-2512s1c1
Sequence:CCGGCCAGATTGTAAATGCTCATTTCTCGAGAAATGAGCATTTACAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005375
VALIDATED
MYB MISSION shRNA shRNA Plasmid DNA
v-myb avian myeloblastosis viral oncogene homolog
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-2596s21c1
Sequence:CCGGCCAGATTGTAAATGCTCATTTCTCGAGAAATGAGCATTTACAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-737s21c1
Sequence:CCGGGCTATCAAGAACCACTGGAATCTCGAGATTCCAGTGGTTCTTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-1099s21c1
Sequence:CCGGGCTCCTAATGTCAACCGAGAACTCGAGTTCTCGGTTGACATTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-927s21c1
Sequence:CCGGACTATTCCTATTACCACATTTCTCGAGAAATGTGGTAATAGGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005375.2-1670s21c1
Sequence:CCGGCCCTCTCATCTAGTAGAAGATCTCGAGATCTTCTACTAGATGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005375.x-3045s1c1
Sequence:CCGGTAAGTGTATGGTCTCAGAACTCTCGAGAGTTCTGAGACCATACACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.x-279s1c1
Sequence:CCGGAACAGAATGGAACAGATGACCTCGAGGTCATCTGTTCCATTCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.1-1013s1c1
Sequence:CCGGGCTCCTAATGTCAACCGAGAACTCGAGTTCTCGGTTGACATTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005375.1-1845s1c1
Sequence:CCGGGCATCAGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.1-2512s1c1
Sequence:CCGGCCAGATTGTAAATGCTCATTTCTCGAGAAATGAGCATTTACAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005375
VALIDATED
MYB MISSION shRNA Lentiviral Transduction Particles
v-myb avian myeloblastosis viral oncogene homolog
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-2596s21c1
Sequence:CCGGCCAGATTGTAAATGCTCATTTCTCGAGAAATGAGCATTTACAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-737s21c1
Sequence:CCGGGCTATCAAGAACCACTGGAATCTCGAGATTCCAGTGGTTCTTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-1099s21c1
Sequence:CCGGGCTCCTAATGTCAACCGAGAACTCGAGTTCTCGGTTGACATTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005375.2-927s21c1
Sequence:CCGGACTATTCCTATTACCACATTTCTCGAGAAATGTGGTAATAGGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005375.2-1670s21c1
Sequence:CCGGCCCTCTCATCTAGTAGAAGATCTCGAGATCTTCTACTAGATGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005375.x-3045s1c1
Sequence:CCGGTAAGTGTATGGTCTCAGAACTCTCGAGAGTTCTGAGACCATACACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.x-279s1c1
Sequence:CCGGAACAGAATGGAACAGATGACCTCGAGGTCATCTGTTCCATTCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.1-1013s1c1
Sequence:CCGGGCTCCTAATGTCAACCGAGAACTCGAGTTCTCGGTTGACATTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005375.1-1845s1c1
Sequence:CCGGGCATCAGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005375.1-2512s1c1
Sequence:CCGGCCAGATTGTAAATGCTCATTTCTCGAGAAATGAGCATTTACAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)