EMAIL THIS PAGE TO A FRIEND

MYBBP1A

MYB binding protein (P160) 1a

142 Gene Product Result for
Synonyms: P160 PAP2
UniProtKB ID: Q9BQG0, Q86VM3, Q9BW49, Q9P0V5, Q9UF99
Gene ID:
Mouse(18432) MYB binding protein (P160) 1a
Rat(60571) MYB binding protein (P160) 1a
Zebrafish(321277) MYB binding protein (P160) 1a
Zebrafish(100329401) MYB binding protein (P160) 1a
chicken(417491) MYB binding protein (P160) 1a
domestic cat(101088527) MYB binding protein (P160) 1a
cow(513045) MYB binding protein (P160) 1a
Horse(100072728) MYB binding protein (P160) 1a
dog(489442) MYB binding protein (P160) 1a
Zebrafish(100148003) MYB binding protein (P160) 1a
domestic guinea pig(100726753) MYB binding protein (P160) 1a
Domestic Rabbit(100349437) MYB binding protein (P160) 1a
naked mole-rat(101698788) MYB binding protein (P160) 1a
sheep(101112494) MYB binding protein (P160) 1a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014520 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105538 Rosetta Predictions human pricing
NM_014520 Rosetta Predictions human pricing
NM_031668 Rosetta Predictions rat pricing
NM_016776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324271 predicted 1507
2 SASI_Hs02_00324272 predicted 654
3 SASI_Hs02_00324273 predicted 1419
4 SASI_Hs02_00324274 predicted 1383
5 SASI_Hs02_00324275 predicted 1360
6 SASI_Hs02_00324276 predicted 1287
7 SASI_Hs02_00324277 predicted 2821
8 SASI_Hs02_00324278 predicted 1348
9 SASI_Hs02_00324279 predicted 2653
10 SASI_Hs02_00324280 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127868 predicted 658
2 SASI_Hs01_00127869 predicted 1413
3 SASI_Hs01_00127870 predicted 1360
4 SASI_Hs01_00127871 predicted 1292
5 SASI_Hs01_00127872 predicted 2825
6 SASI_Hs01_00127873 predicted 3573
7 SASI_Hs01_00127874 predicted 1342
8 SASI_Hs01_00127875 predicted 2650
9 SASI_Hs02_00345804 predicted 656
10 SASI_Hs02_00345805 predicted 3576
11 SASI_Hs01_00127867 predicted 1474
12 SASI_Hs01_00127876 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050718 predicted 1641
2 SASI_Rn01_00050719 predicted 846
3 SASI_Rn01_00050720 predicted 689
4 SASI_Rn01_00050721 predicted 2638
5 SASI_Rn01_00050722 predicted 2567
6 SASI_Rn01_00050723 predicted 769
7 SASI_Rn01_00050724 predicted 3263
8 SASI_Rn01_00050725 predicted 1465
9 SASI_Rn01_00050726 predicted 1097
10 SASI_Rn01_00050727 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051717 predicted 838
2 SASI_Mm02_00323543 predicted 1844
3 SASI_Mm02_00323544 predicted 3881
4 SASI_Mm01_00051719 predicted 2778
5 SASI_Mm01_00051720 predicted 1618
6 SASI_Mm01_00051721 predicted 1135
7 SASI_Mm01_00051722 predicted 320
8 SASI_Mm01_00051723 predicted 904
9 SASI_Mm02_00323545 predicted 1329
10 SASI_Mm01_00051726 predicted 2478
11 SASI_Mm01_00051718 predicted 1001
12 SASI_Mm01_00051724 predicted 518
13 SASI_Mm01_00051725 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014520
MYBBP1A MISSION shRNA Bacterial Glycerol Stock
MYB binding protein (P160) 1a
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-1468s1c1
Sequence:CCGGCCACTCGTTCTTTGTCACAAACTCGAGTTTGTGACAAAGAACGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-3554s1c1
Sequence:CCGGGAGACGAAGAAGCGCAAGAAACTCGAGTTTCTTGCGCTTCTTCGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-457s21c1
Sequence:CCGGCTCTCTTTGCAAACCTGTTTGCTCGAGCAAACAGGTTTGCAAAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014520.1-4279s1c1
Sequence:CCGGCCTGGGTTGGTGCATGTTGATCTCGAGATCAACATGCACCAACCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-1301s1c1
Sequence:CCGGAGCACCAACAACCAGAAGAAACTCGAGTTTCTTCTGGTTGTTGGTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-229s1c1
Sequence:CCGGCGAGATGAAATATGCCCTGAACTCGAGTTCAGGGCATATTTCATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-663s21c1
Sequence:CCGGCTCAAAGCCGACTTGAATATACTCGAGTATATTCAAGTCGGCTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014520.3-4084s21c1
Sequence:CCGGATCTGCCTGAGACGCCTATTTCTCGAGAAATAGGCGTCTCAGGCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-759s21c1
Sequence:CCGGGTGGGATCCGTGAACCTATTCCTCGAGGAATAGGTTCACGGATCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014520
MYBBP1A MISSION shRNA shRNA Plasmid DNA
MYB binding protein (P160) 1a
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-1468s1c1
Sequence:CCGGCCACTCGTTCTTTGTCACAAACTCGAGTTTGTGACAAAGAACGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-3554s1c1
Sequence:CCGGGAGACGAAGAAGCGCAAGAAACTCGAGTTTCTTGCGCTTCTTCGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-457s21c1
Sequence:CCGGCTCTCTTTGCAAACCTGTTTGCTCGAGCAAACAGGTTTGCAAAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014520.1-4279s1c1
Sequence:CCGGCCTGGGTTGGTGCATGTTGATCTCGAGATCAACATGCACCAACCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-1301s1c1
Sequence:CCGGAGCACCAACAACCAGAAGAAACTCGAGTTTCTTCTGGTTGTTGGTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-229s1c1
Sequence:CCGGCGAGATGAAATATGCCCTGAACTCGAGTTCAGGGCATATTTCATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-663s21c1
Sequence:CCGGCTCAAAGCCGACTTGAATATACTCGAGTATATTCAAGTCGGCTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014520.3-4084s21c1
Sequence:CCGGATCTGCCTGAGACGCCTATTTCTCGAGAAATAGGCGTCTCAGGCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-759s21c1
Sequence:CCGGGTGGGATCCGTGAACCTATTCCTCGAGGAATAGGTTCACGGATCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014520
MYBBP1A MISSION shRNA Lentiviral Transduction Particles
MYB binding protein (P160) 1a
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-1468s1c1
Sequence:CCGGCCACTCGTTCTTTGTCACAAACTCGAGTTTGTGACAAAGAACGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-3554s1c1
Sequence:CCGGGAGACGAAGAAGCGCAAGAAACTCGAGTTTCTTGCGCTTCTTCGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-457s21c1
Sequence:CCGGCTCTCTTTGCAAACCTGTTTGCTCGAGCAAACAGGTTTGCAAAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014520.1-4279s1c1
Sequence:CCGGCCTGGGTTGGTGCATGTTGATCTCGAGATCAACATGCACCAACCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-1301s1c1
Sequence:CCGGAGCACCAACAACCAGAAGAAACTCGAGTTTCTTCTGGTTGTTGGTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014520.1-229s1c1
Sequence:CCGGCGAGATGAAATATGCCCTGAACTCGAGTTCAGGGCATATTTCATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-663s21c1
Sequence:CCGGCTCAAAGCCGACTTGAATATACTCGAGTATATTCAAGTCGGCTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014520.3-4084s21c1
Sequence:CCGGATCTGCCTGAGACGCCTATTTCTCGAGAAATAGGCGTCTCAGGCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014520.3-759s21c1
Sequence:CCGGGTGGGATCCGTGAACCTATTCCTCGAGGAATAGGTTCACGGATCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016776
VALIDATED
MYBBP1A MISSION shRNA Bacterial Glycerol Stock
MYB binding protein (P160) 1a
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-465s1c1
Sequence:CCGGCCTGATGAAGTCCGTGCAATTCTCGAGAATTGCACGGACTTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-2951s1c1
Sequence:CCGGCCAAGCGTAACAGCTCACTTACTCGAGTAAGTGAGCTGTTACGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-4060s1c1
Sequence:CCGGCCTGCCCTAGAGACTCCTATTCTCGAGAATAGGAGTCTCTAGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-2010s1c1
Sequence:CCGGCCGGAGTGTATTTGGTCATATCTCGAGATATGACCAAATACACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-193s1c1
Sequence:CCGGCCCAATGATTCGGAGATGAAACTCGAGTTTCATCTCCGAATCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-2751s21c1
Sequence:CCGGTGATGCCTCTGTCGCCCTATACTCGAGTATAGGGCGACAGAGGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-1099s21c1
Sequence:CCGGCCTAAGCGGCAGTTGACTATGCTCGAGCATAGTCAACTGCCGCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-4060s21c1
Sequence:CCGGCCTGCCCTAGAGACTCCTATTCTCGAGAATAGGAGTCTCTAGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-2826s21c1
Sequence:CCGGGAGGCACCAAGATGGTCATAACTCGAGTTATGACCATCTTGGTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-213s21c1
Sequence:CCGGATATGCCCTGAAGCGCCTAATCTCGAGATTAGGCGCTTCAGGGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016776
VALIDATED
MYBBP1A MISSION shRNA shRNA Plasmid DNA
MYB binding protein (P160) 1a
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-465s1c1
Sequence:CCGGCCTGATGAAGTCCGTGCAATTCTCGAGAATTGCACGGACTTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-2951s1c1
Sequence:CCGGCCAAGCGTAACAGCTCACTTACTCGAGTAAGTGAGCTGTTACGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-4060s1c1
Sequence:CCGGCCTGCCCTAGAGACTCCTATTCTCGAGAATAGGAGTCTCTAGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-2010s1c1
Sequence:CCGGCCGGAGTGTATTTGGTCATATCTCGAGATATGACCAAATACACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-193s1c1
Sequence:CCGGCCCAATGATTCGGAGATGAAACTCGAGTTTCATCTCCGAATCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-2751s21c1
Sequence:CCGGTGATGCCTCTGTCGCCCTATACTCGAGTATAGGGCGACAGAGGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-1099s21c1
Sequence:CCGGCCTAAGCGGCAGTTGACTATGCTCGAGCATAGTCAACTGCCGCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-4060s21c1
Sequence:CCGGCCTGCCCTAGAGACTCCTATTCTCGAGAATAGGAGTCTCTAGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-2826s21c1
Sequence:CCGGGAGGCACCAAGATGGTCATAACTCGAGTTATGACCATCTTGGTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-213s21c1
Sequence:CCGGATATGCCCTGAAGCGCCTAATCTCGAGATTAGGCGCTTCAGGGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016776
VALIDATED
MYBBP1A MISSION shRNA Lentiviral Transduction Particles
MYB binding protein (P160) 1a
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-465s1c1
Sequence:CCGGCCTGATGAAGTCCGTGCAATTCTCGAGAATTGCACGGACTTCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-2951s1c1
Sequence:CCGGCCAAGCGTAACAGCTCACTTACTCGAGTAAGTGAGCTGTTACGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-4060s1c1
Sequence:CCGGCCTGCCCTAGAGACTCCTATTCTCGAGAATAGGAGTCTCTAGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-2010s1c1
Sequence:CCGGCCGGAGTGTATTTGGTCATATCTCGAGATATGACCAAATACACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016776.2-193s1c1
Sequence:CCGGCCCAATGATTCGGAGATGAAACTCGAGTTTCATCTCCGAATCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-2751s21c1
Sequence:CCGGTGATGCCTCTGTCGCCCTATACTCGAGTATAGGGCGACAGAGGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-1099s21c1
Sequence:CCGGCCTAAGCGGCAGTTGACTATGCTCGAGCATAGTCAACTGCCGCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-4060s21c1
Sequence:CCGGCCTGCCCTAGAGACTCCTATTCTCGAGAATAGGAGTCTCTAGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-2826s21c1
Sequence:CCGGGAGGCACCAAGATGGTCATAACTCGAGTTATGACCATCTTGGTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016776.2-213s21c1
Sequence:CCGGATATGCCCTGAAGCGCCTAATCTCGAGATTAGGCGCTTCAGGGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)