EMAIL THIS PAGE TO A FRIEND

MYBL1

v-myb avian myeloblastosis viral oncogene homolog-like 1

246 Gene Product Result for
Synonyms: A-MYB AMYB
UniProtKB ID: P10243, E7EW29, Q495F9
Gene ID:
Mouse(17864) myeloblastosis oncogene-like 1
Rat(297783) myeloblastosis oncogene-like 1
Zebrafish(558540) v-myb myeloblastosis viral oncogene homolog (avian)-like 1
cow(338034) v-myb myeloblastosis viral oncogene homolog (avian)-like 1
domestic cat(101089490) v-myb myeloblastosis viral oncogene homolog (avian)-like 1
dog(486979) v-myb myeloblastosis viral oncogene homolog (avian)-like 1
chicken(396158) v-myb myeloblastosis viral oncogene homolog-like 1
sheep(101121782) v-myb myeloblastosis viral oncogene homolog (avian)-like 1
naked mole-rat(101714343) v-myb myeloblastosis viral oncogene homolog (avian)-like 1
domestic guinea pig(100718001) v-myb myeloblastosis viral oncogene homolog (avian)-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144755 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_034274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_034274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_034274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080416 Rosetta Predictions human pricing
XM_034274 Rosetta Predictions human pricing
XM_933454 Rosetta Predictions human pricing
XM_933458 Rosetta Predictions human pricing
XM_933459 Rosetta Predictions human pricing
XM_933460 Rosetta Predictions human pricing
XM_933462 Rosetta Predictions human pricing
NM_001106632 Rosetta Predictions rat pricing
NM_008651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314636 predicted 2289
2 SASI_Hs02_00314637 predicted 794
3 SASI_Hs02_00314638 predicted 1720
4 SASI_Hs02_00314639 predicted 718
5 SASI_Hs02_00314640 predicted 2183
6 SASI_Hs02_00314641 predicted 1845
7 SASI_Hs02_00314642 predicted 1650
8 SASI_Hs02_00314643 predicted 730
9 SASI_Hs02_00314644 predicted 1645
10 SASI_Hs02_00314645 predicted 2238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_034274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280258 predicted 2065
2 SASI_Hs01_00280259 predicted 2025
3 SASI_Hs01_00280260 predicted 1016
4 SASI_Hs01_00280261 predicted 2030
5 SASI_Hs01_00280262 predicted 1036
6 SASI_Hs01_00280263 predicted 1971
7 SASI_Hs01_00280264 predicted 1049
8 SASI_Hs01_00280265 predicted 1955
9 SASI_Hs01_00280266 predicted 1895
10 SASI_Hs01_00280267 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265983 predicted 573
2 SASI_Hs01_00265984 predicted 549
3 SASI_Hs01_00265985 predicted 579
4 SASI_Hs01_00265986 predicted 684
5 SASI_Hs01_00265987 predicted 699
6 SASI_Hs01_00265988 predicted 570
7 SASI_Hs01_00265989 predicted 594
8 SASI_Hs01_00265990 predicted 627
9 SASI_Hs01_00265991 predicted 543
10 SASI_Hs01_00265992 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299782 predicted 1734
2 SASI_Hs01_00299783 predicted 688
3 SASI_Hs01_00299784 predicted 1709
4 SASI_Hs01_00299785 predicted 703
5 SASI_Hs01_00299786 predicted 1638
6 SASI_Hs01_00299787 predicted 725
7 SASI_Hs01_00299788 predicted 1629
8 SASI_Hs01_00299789 predicted 1573
9 SASI_Hs01_00299790 predicted 300
10 SASI_Hs01_00299791 predicted 1745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296734 predicted 876
2 SASI_Hs01_00296735 predicted 1411
3 SASI_Hs01_00296736 predicted 834
4 SASI_Hs01_00296737 predicted 1177
5 SASI_Hs01_00296738 predicted 841
6 SASI_Hs01_00296739 predicted 1513
7 SASI_Hs01_00296740 predicted 1303
8 SASI_Hs01_00296741 predicted 966
9 SASI_Hs01_00296742 predicted 777
10 SASI_Hs01_00296743 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257988 predicted 872
2 SASI_Hs01_00257989 predicted 841
3 SASI_Hs01_00257990 predicted 835
4 SASI_Hs01_00257991 predicted 778
5 SASI_Hs01_00257992 predicted 844
6 SASI_Hs01_00257993 predicted 760
7 SASI_Hs01_00257994 predicted 771
8 SASI_Hs01_00257995 predicted 768
9 SASI_Hs01_00257996 predicted 824
10 SASI_Hs01_00257997 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295850 predicted 2071
2 SASI_Hs01_00295851 predicted 1021
3 SASI_Hs01_00295852 predicted 2036
4 SASI_Hs01_00295853 predicted 1029
5 SASI_Hs01_00295854 predicted 2162
6 SASI_Hs01_00295855 predicted 1961
7 SASI_Hs01_00295856 predicted 1044
8 SASI_Hs01_00295857 predicted 1953
9 SASI_Hs01_00295858 predicted 1904
10 SASI_Hs01_00295859 predicted 2194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220858 predicted 1259
2 SASI_Rn02_00220859 predicted 1559
3 SASI_Rn02_00220860 predicted 989
4 SASI_Rn02_00220861 predicted 756
5 SASI_Rn02_00220862 predicted 1502
6 SASI_Rn02_00220863 predicted 977
7 SASI_Rn02_00220864 predicted 2489
8 SASI_Rn02_00220865 predicted 924
9 SASI_Rn02_00220866 predicted 794
10 SASI_Rn02_00220867 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141792 predicted 1260
2 SASI_Mm01_00141793 predicted 1433
3 SASI_Mm02_00314400 predicted 2339
4 SASI_Mm02_00314401 predicted 2563
5 SASI_Mm01_00141795 predicted 1412
6 SASI_Mm02_00314402 predicted 2394
7 SASI_Mm02_00314403 predicted 1332
8 SASI_Mm01_00141796 predicted 1465
9 SASI_Mm01_00141797 predicted 1527
10 SASI_Mm01_00141799 predicted 637
11 SASI_Mm01_00141794 predicted 1077
12 SASI_Mm01_00141798 predicted 1391
13 SASI_Mm01_00141800 predicted 1411
14 SASI_Mm01_00141801 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144755
MYBL1 MISSION shRNA Bacterial Glycerol Stock
v-myb avian myeloblastosis viral oncogene homolog-like 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000434113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144755.1-1616s21c1
Sequence:CCGGAGCCATGGAATGCCAATTTAACTCGAGTTAAATTGGCATTCCATGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144755.1-780s21c1
Sequence:CCGGTGTAGAGAAAGATGGCATAATCTCGAGATTATGCCATCTTTCTCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144755
MYBL1 MISSION shRNA shRNA Plasmid DNA
v-myb avian myeloblastosis viral oncogene homolog-like 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000434113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144755.1-1616s21c1
Sequence:CCGGAGCCATGGAATGCCAATTTAACTCGAGTTAAATTGGCATTCCATGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144755.1-780s21c1
Sequence:CCGGTGTAGAGAAAGATGGCATAATCTCGAGATTATGCCATCTTTCTCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144755
MYBL1 MISSION shRNA Lentiviral Transduction Particles
v-myb avian myeloblastosis viral oncogene homolog-like 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000434113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144755.1-1616s21c1
Sequence:CCGGAGCCATGGAATGCCAATTTAACTCGAGTTAAATTGGCATTCCATGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144755.1-780s21c1
Sequence:CCGGTGTAGAGAAAGATGGCATAATCTCGAGATTATGCCATCTTTCTCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008651
MYBL1 MISSION shRNA Bacterial Glycerol Stock
v-myb avian myeloblastosis viral oncogene homolog-like 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008651.2-1864s21c1
Sequence:CCGGGGATTCAGAACTCCTACTATTCTCGAGAATAGTAGGAGTTCTGAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008651.2-941s21c1
Sequence:CCGGAGATCCCTGGGTATCAGTATGCTCGAGCATACTGATACCCAGGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-2080s1c1
Sequence:CCGGCCAAACCCTAACCCTTGTAAACTCGAGTTTACAAGGGTTAGGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-816s1c1
Sequence:CCGGGCTTCTTATGTCAGCCGAGAACTCGAGTTCTCGGCTGACATAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-1006s1c1
Sequence:CCGGCCCACAAAGTTCCTAGCTGTACTCGAGTACAGCTAGGAACTTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-2091s1c1
Sequence:CCGGCCCTTGTAAAGCTGTCAAATTCTCGAGAATTTGACAGCTTTACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-748s1c1
Sequence:CCGGGCCTTTATTCAGCAACCCTTTCTCGAGAAAGGGTTGCTGAATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008651
MYBL1 MISSION shRNA shRNA Plasmid DNA
v-myb avian myeloblastosis viral oncogene homolog-like 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008651.2-1864s21c1
Sequence:CCGGGGATTCAGAACTCCTACTATTCTCGAGAATAGTAGGAGTTCTGAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008651.2-941s21c1
Sequence:CCGGAGATCCCTGGGTATCAGTATGCTCGAGCATACTGATACCCAGGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-2080s1c1
Sequence:CCGGCCAAACCCTAACCCTTGTAAACTCGAGTTTACAAGGGTTAGGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-816s1c1
Sequence:CCGGGCTTCTTATGTCAGCCGAGAACTCGAGTTCTCGGCTGACATAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-1006s1c1
Sequence:CCGGCCCACAAAGTTCCTAGCTGTACTCGAGTACAGCTAGGAACTTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-2091s1c1
Sequence:CCGGCCCTTGTAAAGCTGTCAAATTCTCGAGAATTTGACAGCTTTACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-748s1c1
Sequence:CCGGGCCTTTATTCAGCAACCCTTTCTCGAGAAAGGGTTGCTGAATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008651
MYBL1 MISSION shRNA Lentiviral Transduction Particles
v-myb avian myeloblastosis viral oncogene homolog-like 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008651.2-1864s21c1
Sequence:CCGGGGATTCAGAACTCCTACTATTCTCGAGAATAGTAGGAGTTCTGAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008651.2-941s21c1
Sequence:CCGGAGATCCCTGGGTATCAGTATGCTCGAGCATACTGATACCCAGGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-2080s1c1
Sequence:CCGGCCAAACCCTAACCCTTGTAAACTCGAGTTTACAAGGGTTAGGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-816s1c1
Sequence:CCGGGCTTCTTATGTCAGCCGAGAACTCGAGTTCTCGGCTGACATAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-1006s1c1
Sequence:CCGGCCCACAAAGTTCCTAGCTGTACTCGAGTACAGCTAGGAACTTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-2091s1c1
Sequence:CCGGCCCTTGTAAAGCTGTCAAATTCTCGAGAATTTGACAGCTTTACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008651.1-748s1c1
Sequence:CCGGGCCTTTATTCAGCAACCCTTTCTCGAGAAAGGGTTGCTGAATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_034274
MYBL1 MISSION shRNA Bacterial Glycerol Stock
v-myb avian myeloblastosis viral oncogene homolog-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1177s1c1
Sequence:CCGGGCAGAGACTCTAGAACTTATTCTCGAGAATAAGTTCTAGAGTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-580s1c1
Sequence:CCGGCGTTGGGCAGAAATTGCCAAACTCGAGTTTGGCAATTTCTGCCCAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1837s1c1
Sequence:CCGGCCACTTGCTTTCTTGGAAGAACTCGAGTTCTTCCAAGAAAGCAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1643s1c1
Sequence:CCGGGTGGGCAGAAAGCTCTCATTACTCGAGTAATGAGAGCTTTCTGCCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-151s1c1
Sequence:CCGGGCCGATCATGATTATGAAGTACTCGAGTACTTCATAATCATGATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_034274
MYBL1 MISSION shRNA shRNA Plasmid DNA
v-myb avian myeloblastosis viral oncogene homolog-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1177s1c1
Sequence:CCGGGCAGAGACTCTAGAACTTATTCTCGAGAATAAGTTCTAGAGTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-580s1c1
Sequence:CCGGCGTTGGGCAGAAATTGCCAAACTCGAGTTTGGCAATTTCTGCCCAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1837s1c1
Sequence:CCGGCCACTTGCTTTCTTGGAAGAACTCGAGTTCTTCCAAGAAAGCAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1643s1c1
Sequence:CCGGGTGGGCAGAAAGCTCTCATTACTCGAGTAATGAGAGCTTTCTGCCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-151s1c1
Sequence:CCGGGCCGATCATGATTATGAAGTACTCGAGTACTTCATAATCATGATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_034274
MYBL1 MISSION shRNA Lentiviral Transduction Particles
v-myb avian myeloblastosis viral oncogene homolog-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1177s1c1
Sequence:CCGGGCAGAGACTCTAGAACTTATTCTCGAGAATAAGTTCTAGAGTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-580s1c1
Sequence:CCGGCGTTGGGCAGAAATTGCCAAACTCGAGTTTGGCAATTTCTGCCCAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1837s1c1
Sequence:CCGGCCACTTGCTTTCTTGGAAGAACTCGAGTTCTTCCAAGAAAGCAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-1643s1c1
Sequence:CCGGGTGGGCAGAAAGCTCTCATTACTCGAGTAATGAGAGCTTTCTGCCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034274.12-151s1c1
Sequence:CCGGGCCGATCATGATTATGAAGTACTCGAGTACTTCATAATCATGATCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)