EMAIL THIS PAGE TO A FRIEND

MYBL2

v-myb avian myeloblastosis viral oncogene homolog-like 2

103 Gene Product Result for
Synonyms: B-MYB BMYB
UniProtKB ID: P10244, B2RBS5
Gene ID:
Human(4605) Summary: The protein encoded by this gene, a member of the MYB family of transcription factor genes, is a nuclear protein involved in cell cycle progression. The encoded protein is phosphorylated by cyclin A/cyclin-dependent kinase 2 during the S-phase of the cell cycle and possesses both activator and repressor activities. It has been shown to activate the cell division cycle 2, cyclin D1, and insulin-like growth factor-binding protein 5 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
Mouse(17865) myeloblastosis oncogene-like 2
Rat(296344) myeloblastosis oncogene-like 2
domestic guinea pig(100735268) v-myb myeloblastosis viral oncogene homolog (avian)-like 2
naked mole-rat(101715853) v-myb myeloblastosis viral oncogene homolog (avian)-like 2
Domestic Rabbit(100346753) v-myb myeloblastosis viral oncogene homolog (avian)-like 2
sheep(101105095) v-myb myeloblastosis viral oncogene homolog (avian)-like 2
Zebrafish(445390) myeloblastosis oncogene-like 2
chicken(396258) v-myb myeloblastosis viral oncogene homolog-like 2
Thale Cress(843443) putative myb family transcription factor
dog(477232) v-myb myeloblastosis viral oncogene homolog (avian)-like 2
cow(510420) v-myb myeloblastosis viral oncogene homolog (avian)-like 2
Horse(100070694) v-myb myeloblastosis viral oncogene homolog (avian)-like 2
domestic cat(101095245) v-myb myeloblastosis viral oncogene homolog (avian)-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501939 Anti-B-MYB antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB2500168 Anti-BMYB/MYBL2 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, rat, human
ELISA, western blot pricing
SAB2108451 Anti-MYBL2 affinity isolated antibody human
immunohistochemistry, western blot pricing
AV100748 Anti-MyBL2 antibody produced in rabbit affinity isolated antibody guinea pig, canine, horse, zebrafish, rat, bovine, rabbit, human
immunohistochemistry, western blot pricing
HPA030530 Anti-MYBL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410805 Anti-MYBL2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
HPA055416 Anti-MYBL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4504115 Anti-phospho-B-Myb (pSer577/581) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
WH0004605M1 Monoclonal Anti-MYBL2 antibody produced in mouse clone 4B4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409333 Monoclonal Anti-MYBL2 antibody produced in mouse clone 3B6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404099 Monoclonal Anti-MYBL2, (C-terminal) antibody produced in mouse clone 1C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002466 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU052991 MISSION® esiRNA esiRNA targeting mouse Mybl2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002466 Rosetta Predictions human pricing
NM_001106536 Rosetta Predictions rat pricing
NM_008652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079499 predicted 1541
2 SASI_Hs01_00079500 predicted 1060
3 SASI_Hs01_00079501 predicted 768
4 SASI_Hs01_00079502 predicted 804
5 SASI_Hs01_00079503 predicted 1974
6 SASI_Hs01_00079504 predicted 1485
7 SASI_Hs01_00079506 predicted 2018
8 SASI_Hs01_00079507 predicted 535
9 SASI_Hs01_00079508 predicted 1699
10 SASI_Hs02_00333888 predicted 1572
11 SASI_Hs01_00079505 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219918 predicted 1934
2 SASI_Rn02_00219919 predicted 1331
3 SASI_Rn02_00219920 predicted 2372
4 SASI_Rn02_00219921 predicted 1159
5 SASI_Rn02_00219922 predicted 2210
6 SASI_Rn02_00219923 predicted 701
7 SASI_Rn02_00219924 predicted 1783
8 SASI_Rn02_00219925 predicted 779
9 SASI_Rn02_00219926 predicted 2317
10 SASI_Rn02_00219927 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088753 predicted 485
2 SASI_Mm01_00088754 predicted 1934
3 SASI_Mm01_00088755 predicted 1322
4 SASI_Mm01_00088756 predicted 622
5 SASI_Mm02_00314404 predicted 879
6 SASI_Mm01_00088757 predicted 589
7 SASI_Mm01_00088759 predicted 1703
8 SASI_Mm01_00088760 predicted 507
9 SASI_Mm01_00088761 predicted 1315
10 SASI_Mm01_00088762 predicted 1058
11 SASI_Mm01_00088758 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008652
VALIDATED
MYBL2 MISSION shRNA Bacterial Glycerol Stock
v-myb avian myeloblastosis viral oncogene homolog-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-1005s1c1
Sequence:CCGGCCAGAATCTCTCAAGCGTGAACTCGAGTTCACGCTTGAGAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-486s1c1
Sequence:CCGGGTCAAGAAGTATGGCACCAAACTCGAGTTTGGTGCCATACTTCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-271s1c1
Sequence:CCGGGAGACAACAGATGTAAGGTTACTCGAGTAACCTTACATCTGTTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-939s1c1
Sequence:CCGGTCTGCTAAAGAACTCGGACATCTCGAGATGTCCGAGTTCTTTAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-1965s1c1
Sequence:CCGGGCTCTCGACATTATGGATGAACTCGAGTTCATCCATAATGTCGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-939s21c1
Sequence:CCGGTCTGCTAAAGAACTCGGACATCTCGAGATGTCCGAGTTCTTTAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008652.2-2794s21c1
Sequence:CCGGAGCTCCCAAGAACTATGTATGCTCGAGCATACATAGTTCTTGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-271s21c1
Sequence:CCGGGAGACAACAGATGTAAGGTTACTCGAGTAACCTTACATCTGTTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-1005s21c1
Sequence:CCGGCCAGAATCTCTCAAGCGTGAACTCGAGTTCACGCTTGAGAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008652
VALIDATED
MYBL2 MISSION shRNA shRNA Plasmid DNA
v-myb avian myeloblastosis viral oncogene homolog-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-1005s1c1
Sequence:CCGGCCAGAATCTCTCAAGCGTGAACTCGAGTTCACGCTTGAGAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-486s1c1
Sequence:CCGGGTCAAGAAGTATGGCACCAAACTCGAGTTTGGTGCCATACTTCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-271s1c1
Sequence:CCGGGAGACAACAGATGTAAGGTTACTCGAGTAACCTTACATCTGTTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-939s1c1
Sequence:CCGGTCTGCTAAAGAACTCGGACATCTCGAGATGTCCGAGTTCTTTAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-1965s1c1
Sequence:CCGGGCTCTCGACATTATGGATGAACTCGAGTTCATCCATAATGTCGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-939s21c1
Sequence:CCGGTCTGCTAAAGAACTCGGACATCTCGAGATGTCCGAGTTCTTTAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008652.2-2794s21c1
Sequence:CCGGAGCTCCCAAGAACTATGTATGCTCGAGCATACATAGTTCTTGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-271s21c1
Sequence:CCGGGAGACAACAGATGTAAGGTTACTCGAGTAACCTTACATCTGTTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-1005s21c1
Sequence:CCGGCCAGAATCTCTCAAGCGTGAACTCGAGTTCACGCTTGAGAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008652
VALIDATED
MYBL2 MISSION shRNA Lentiviral Transduction Particles
v-myb avian myeloblastosis viral oncogene homolog-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-1005s1c1
Sequence:CCGGCCAGAATCTCTCAAGCGTGAACTCGAGTTCACGCTTGAGAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-486s1c1
Sequence:CCGGGTCAAGAAGTATGGCACCAAACTCGAGTTTGGTGCCATACTTCTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-271s1c1
Sequence:CCGGGAGACAACAGATGTAAGGTTACTCGAGTAACCTTACATCTGTTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-939s1c1
Sequence:CCGGTCTGCTAAAGAACTCGGACATCTCGAGATGTCCGAGTTCTTTAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008652.2-1965s1c1
Sequence:CCGGGCTCTCGACATTATGGATGAACTCGAGTTCATCCATAATGTCGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-939s21c1
Sequence:CCGGTCTGCTAAAGAACTCGGACATCTCGAGATGTCCGAGTTCTTTAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008652.2-2794s21c1
Sequence:CCGGAGCTCCCAAGAACTATGTATGCTCGAGCATACATAGTTCTTGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-271s21c1
Sequence:CCGGGAGACAACAGATGTAAGGTTACTCGAGTAACCTTACATCTGTTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008652.2-1005s21c1
Sequence:CCGGCCAGAATCTCTCAAGCGTGAACTCGAGTTCACGCTTGAGAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002466
VALIDATED
MYBL2 MISSION shRNA Bacterial Glycerol Stock
v-myb avian myeloblastosis viral oncogene homolog-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-2515s1c1
Sequence:CCGGGCTAACAACAAAGTTCCACTTCTCGAGAAGTGGAACTTTGTTGTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1971s1c1
Sequence:CCGGCTGGCTCTTGACATTGTGGATCTCGAGATCCACAATGTCAAGAGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1176s1c1
Sequence:CCGGGCTTGGTGTGACCTGAGTAAACTCGAGTTTACTCAGGTCACACCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1227s1c1
Sequence:CCGGGACAGTATCAACAACAGCCTACTCGAGTAGGCTGTTGTTGATACTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1730s1c1
Sequence:CCGGCCCAGATCAGAAGTACTCCATCTCGAGATGGAGTACTTCTGATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1176s21c1
Sequence:CCGGGCTTGGTGTGACCTGAGTAAACTCGAGTTTACTCAGGTCACACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1227s21c1
Sequence:CCGGGACAGTATCAACAACAGCCTACTCGAGTAGGCTGTTGTTGATACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1971s21c1
Sequence:CCGGCTGGCTCTTGACATTGTGGATCTCGAGATCCACAATGTCAAGAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1730s21c1
Sequence:CCGGCCCAGATCAGAAGTACTCCATCTCGAGATGGAGTACTTCTGATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-2515s21c1
Sequence:CCGGGCTAACAACAAAGTTCCACTTCTCGAGAAGTGGAACTTTGTTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002466
VALIDATED
MYBL2 MISSION shRNA shRNA Plasmid DNA
v-myb avian myeloblastosis viral oncogene homolog-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-2515s1c1
Sequence:CCGGGCTAACAACAAAGTTCCACTTCTCGAGAAGTGGAACTTTGTTGTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1971s1c1
Sequence:CCGGCTGGCTCTTGACATTGTGGATCTCGAGATCCACAATGTCAAGAGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1176s1c1
Sequence:CCGGGCTTGGTGTGACCTGAGTAAACTCGAGTTTACTCAGGTCACACCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1227s1c1
Sequence:CCGGGACAGTATCAACAACAGCCTACTCGAGTAGGCTGTTGTTGATACTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1730s1c1
Sequence:CCGGCCCAGATCAGAAGTACTCCATCTCGAGATGGAGTACTTCTGATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1176s21c1
Sequence:CCGGGCTTGGTGTGACCTGAGTAAACTCGAGTTTACTCAGGTCACACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1227s21c1
Sequence:CCGGGACAGTATCAACAACAGCCTACTCGAGTAGGCTGTTGTTGATACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1971s21c1
Sequence:CCGGCTGGCTCTTGACATTGTGGATCTCGAGATCCACAATGTCAAGAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1730s21c1
Sequence:CCGGCCCAGATCAGAAGTACTCCATCTCGAGATGGAGTACTTCTGATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-2515s21c1
Sequence:CCGGGCTAACAACAAAGTTCCACTTCTCGAGAAGTGGAACTTTGTTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002466
VALIDATED
MYBL2 MISSION shRNA Lentiviral Transduction Particles
v-myb avian myeloblastosis viral oncogene homolog-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-2515s1c1
Sequence:CCGGGCTAACAACAAAGTTCCACTTCTCGAGAAGTGGAACTTTGTTGTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1971s1c1
Sequence:CCGGCTGGCTCTTGACATTGTGGATCTCGAGATCCACAATGTCAAGAGCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1176s1c1
Sequence:CCGGGCTTGGTGTGACCTGAGTAAACTCGAGTTTACTCAGGTCACACCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1227s1c1
Sequence:CCGGGACAGTATCAACAACAGCCTACTCGAGTAGGCTGTTGTTGATACTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002466.2-1730s1c1
Sequence:CCGGCCCAGATCAGAAGTACTCCATCTCGAGATGGAGTACTTCTGATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1176s21c1
Sequence:CCGGGCTTGGTGTGACCTGAGTAAACTCGAGTTTACTCAGGTCACACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1227s21c1
Sequence:CCGGGACAGTATCAACAACAGCCTACTCGAGTAGGCTGTTGTTGATACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1971s21c1
Sequence:CCGGCTGGCTCTTGACATTGTGGATCTCGAGATCCACAATGTCAAGAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-1730s21c1
Sequence:CCGGCCCAGATCAGAAGTACTCCATCTCGAGATGGAGTACTTCTGATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002466.2-2515s21c1
Sequence:CCGGGCTAACAACAAAGTTCCACTTCTCGAGAAGTGGAACTTTGTTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)