EMAIL THIS PAGE TO A FRIEND

MYBPC1

myosin binding protein C, slow type

127 Gene Product Result for
Synonyms: LCCS4 MYBPCC MYBPCS
Gene ID:
Human(4604) Summary: This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(109272) myosin binding protein C, slow-type
Rat(362867) myosin binding protein C, slow type
Zebrafish(492356) myosin binding protein C, slow type
chicken(418099) myosin binding protein C, slow type
domestic cat(101099481) myosin binding protein C, slow type
cow(510763) myosin binding protein C, slow type
Horse(100053073) myosin binding protein C, slow type
dog(475442) myosin binding protein C, slow type
sheep(101107588) myosin binding protein C, slow type
Domestic Rabbit(100353416) myosin binding protein C, slow type
naked mole-rat(101704893) myosin binding protein C, slow type
domestic guinea pig(100719256) myosin binding protein C, slow type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002465 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089061 MISSION® esiRNA esiRNA human MYBPC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002465 Rosetta Predictions human pricing
NM_206819 Rosetta Predictions human pricing
NM_206820 Rosetta Predictions human pricing
NM_206821 Rosetta Predictions human pricing
XM_001076591 Rosetta Predictions rat pricing
XM_343196 Rosetta Predictions rat pricing
NM_175418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017154 predicted 3302
2 SASI_Hs01_00017155 predicted 1993
3 SASI_Hs01_00017156 predicted 1597
4 SASI_Hs01_00017157 predicted 604
5 SASI_Hs01_00017158 predicted 3000
6 SASI_Hs02_00333886 predicted 1086
7 SASI_Hs01_00017159 predicted 1126
8 SASI_Hs01_00017160 predicted 2068
9 SASI_Hs02_00333887 predicted 2117
10 SASI_Hs01_00017162 predicted 1957
11 SASI_Hs01_00017161 predicted 1404
12 SASI_Hs01_00017163 predicted 3104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153235 predicted 3303
2 SASI_Hs01_00153236 predicted 1999
3 SASI_Hs01_00153237 predicted 1595
4 SASI_Hs01_00153238 predicted 606
5 SASI_Hs01_00153239 predicted 3003
6 SASI_Hs02_00373539 predicted 1086
7 SASI_Hs01_00153240 predicted 1122
8 SASI_Hs01_00153241 predicted 2066
9 SASI_Hs02_00373540 predicted 2120
10 SASI_Hs01_00153243 predicted 1961
11 SASI_Hs01_00153242 predicted 1413
12 SASI_Hs01_00153244 predicted 3106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233411 predicted 3278
2 SASI_Hs01_00233412 predicted 1926
3 SASI_Hs01_00233413 predicted 1519
4 SASI_Hs01_00233414 predicted 525
5 SASI_Hs01_00233415 predicted 2981
6 SASI_Hs02_00373541 predicted 1010
7 SASI_Hs01_00233416 predicted 1042
8 SASI_Hs01_00233417 predicted 1992
9 SASI_Hs02_00373542 predicted 2040
10 SASI_Hs01_00233419 predicted 1886
11 SASI_Hs01_00233418 predicted 1332
12 SASI_Hs01_00233420 predicted 3084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166918 predicted 3221
2 SASI_Hs01_00166919 predicted 1921
3 SASI_Hs01_00166920 predicted 1523
4 SASI_Hs01_00166921 predicted 532
5 SASI_Hs01_00166922 predicted 2927
6 SASI_Hs02_00373543 predicted 1011
7 SASI_Hs01_00166923 predicted 1050
8 SASI_Hs01_00166924 predicted 1996
9 SASI_Hs02_00373544 predicted 2038
10 SASI_Hs01_00166926 predicted 1879
11 SASI_Hs01_00166925 predicted 1335
12 SASI_Hs01_00166927 predicted 3029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353813 predicted 2392
2 SASI_Rn02_00353814 predicted 2740
3 SASI_Rn02_00353815 predicted 940
4 SASI_Rn02_00353816 predicted 2683
5 SASI_Rn02_00353817 predicted 1293
6 SASI_Rn02_00353818 predicted 829
7 SASI_Rn02_00353819 predicted 1870
8 SASI_Rn02_00353820 predicted 1265
9 SASI_Rn02_00353821 predicted 2783
10 SASI_Rn02_00353822 predicted 2055
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395483 predicted 2368
2 SASI_Rn02_00395484 predicted 2782
3 SASI_Rn02_00395485 predicted 936
4 SASI_Rn02_00395486 predicted 2721
5 SASI_Rn02_00395487 predicted 1302
6 SASI_Rn02_00395488 predicted 3540
7 SASI_Rn02_00395489 predicted 1860
8 SASI_Rn02_00395490 predicted 1269
9 SASI_Rn02_00395491 predicted 2816
10 SASI_Rn02_00395492 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163655 predicted 3289
2 SASI_Mm02_00346294 predicted 488
3 SASI_Mm01_00163658 predicted 2443
4 SASI_Mm01_00163659 predicted 274
5 SASI_Mm01_00163660 predicted 1988
6 SASI_Mm02_00346295 predicted 2070
7 SASI_Mm01_00163661 predicted 1222
8 SASI_Mm01_00163662 predicted 522
9 SASI_Mm01_00163663 predicted 3009
10 SASI_Mm02_00346296 predicted 1188
11 SASI_Mm01_00163656 predicted 1875
12 SASI_Mm01_00163657 predicted 889
13 SASI_Mm01_00163664 predicted 1433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175418
MYBPC1 MISSION shRNA Bacterial Glycerol Stock
myosin binding protein C, slow type
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-2008s21c1
Sequence:CCGGACTCTGGTGTGTACAACATAACTCGAGTTATGTTGTACACACCAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175418.3-3559s1c1
Sequence:CCGGCGAGACTTACAATCAAGCAATCTCGAGATTGCTTGATTGTAAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-3035s1c1
Sequence:CCGGCGAGTATTACTTCCGGGTCTTCTCGAGAAGACCCGGAAGTAATACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-870s1c1
Sequence:CCGGCCTGCATATCAGGTGGATAAACTCGAGTTTATCCACCTGATATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-2802s1c1
Sequence:CCGGGCCTCTATCGACATCCAGATTCTCGAGAATCTGGATGTCGATAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-1772s1c1
Sequence:CCGGCCGAGCAGATAAGGCTATTATCTCGAGATAATAGCCTTATCTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-1738s21c1
Sequence:CCGGTTACACCAGATGCCTACAATGCTCGAGCATTGTAGGCATCTGGTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-2597s21c1
Sequence:CCGGTGTACGTGTGAAGGCTATTAACTCGAGTTAATAGCCTTCACACGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175418
MYBPC1 MISSION shRNA shRNA Plasmid DNA
myosin binding protein C, slow type
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-2008s21c1
Sequence:CCGGACTCTGGTGTGTACAACATAACTCGAGTTATGTTGTACACACCAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175418.3-3559s1c1
Sequence:CCGGCGAGACTTACAATCAAGCAATCTCGAGATTGCTTGATTGTAAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-3035s1c1
Sequence:CCGGCGAGTATTACTTCCGGGTCTTCTCGAGAAGACCCGGAAGTAATACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-870s1c1
Sequence:CCGGCCTGCATATCAGGTGGATAAACTCGAGTTTATCCACCTGATATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-2802s1c1
Sequence:CCGGGCCTCTATCGACATCCAGATTCTCGAGAATCTGGATGTCGATAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-1772s1c1
Sequence:CCGGCCGAGCAGATAAGGCTATTATCTCGAGATAATAGCCTTATCTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-1738s21c1
Sequence:CCGGTTACACCAGATGCCTACAATGCTCGAGCATTGTAGGCATCTGGTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-2597s21c1
Sequence:CCGGTGTACGTGTGAAGGCTATTAACTCGAGTTAATAGCCTTCACACGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175418
MYBPC1 MISSION shRNA Lentiviral Transduction Particles
myosin binding protein C, slow type
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-2008s21c1
Sequence:CCGGACTCTGGTGTGTACAACATAACTCGAGTTATGTTGTACACACCAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175418.3-3559s1c1
Sequence:CCGGCGAGACTTACAATCAAGCAATCTCGAGATTGCTTGATTGTAAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-3035s1c1
Sequence:CCGGCGAGTATTACTTCCGGGTCTTCTCGAGAAGACCCGGAAGTAATACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-870s1c1
Sequence:CCGGCCTGCATATCAGGTGGATAAACTCGAGTTTATCCACCTGATATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-2802s1c1
Sequence:CCGGGCCTCTATCGACATCCAGATTCTCGAGAATCTGGATGTCGATAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175418.3-1772s1c1
Sequence:CCGGCCGAGCAGATAAGGCTATTATCTCGAGATAATAGCCTTATCTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-1738s21c1
Sequence:CCGGTTACACCAGATGCCTACAATGCTCGAGCATTGTAGGCATCTGGTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175418.4-2597s21c1
Sequence:CCGGTGTACGTGTGAAGGCTATTAACTCGAGTTAATAGCCTTCACACGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002465
MYBPC1 MISSION shRNA Bacterial Glycerol Stock
myosin binding protein C, slow type
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1218s1c1
Sequence:CCGGGCTGGAAGATACAACTGCTTACTCGAGTAAGCAGTTGTATCTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1632s1c1
Sequence:CCGGCCACAAGTTAGTGATAGCCAACTCGAGTTGGCTATCACTAACTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3772s1c1
Sequence:CCGGCTGCTTTGAAATCTGGTTGAACTCGAGTTCAACCAGATTTCAAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1890s1c1
Sequence:CCGGCCGGATAAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTTATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3703s1c1
Sequence:CCGGCGAGACTTACACTCAAGCAATCTCGAGATTGCTTGAGTGTAAGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3691s1c1
Sequence:CCGGGATTCGTATCTGCGAGACTTACTCGAGTAAGTCTCGCAGATACGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1889s1c1
Sequence:CCGGGCCGGATAAGAACAGAATCTTCTCGAGAAGATTCTGTTCTTATCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-2856s1c1
Sequence:CCGGGCAAGTCAAAGTGGACAAATTCTCGAGAATTTGTCCACTTTGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-3229s1c1
Sequence:CCGGCCAGTGTATGAAGACTTTGATCTCGAGATCAAAGTCTTCATACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002465
MYBPC1 MISSION shRNA shRNA Plasmid DNA
myosin binding protein C, slow type
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1218s1c1
Sequence:CCGGGCTGGAAGATACAACTGCTTACTCGAGTAAGCAGTTGTATCTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1632s1c1
Sequence:CCGGCCACAAGTTAGTGATAGCCAACTCGAGTTGGCTATCACTAACTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3772s1c1
Sequence:CCGGCTGCTTTGAAATCTGGTTGAACTCGAGTTCAACCAGATTTCAAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1890s1c1
Sequence:CCGGCCGGATAAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTTATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3703s1c1
Sequence:CCGGCGAGACTTACACTCAAGCAATCTCGAGATTGCTTGAGTGTAAGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3691s1c1
Sequence:CCGGGATTCGTATCTGCGAGACTTACTCGAGTAAGTCTCGCAGATACGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1889s1c1
Sequence:CCGGGCCGGATAAGAACAGAATCTTCTCGAGAAGATTCTGTTCTTATCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-2856s1c1
Sequence:CCGGGCAAGTCAAAGTGGACAAATTCTCGAGAATTTGTCCACTTTGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-3229s1c1
Sequence:CCGGCCAGTGTATGAAGACTTTGATCTCGAGATCAAAGTCTTCATACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002465
MYBPC1 MISSION shRNA Lentiviral Transduction Particles
myosin binding protein C, slow type
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1218s1c1
Sequence:CCGGGCTGGAAGATACAACTGCTTACTCGAGTAAGCAGTTGTATCTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1632s1c1
Sequence:CCGGCCACAAGTTAGTGATAGCCAACTCGAGTTGGCTATCACTAACTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3772s1c1
Sequence:CCGGCTGCTTTGAAATCTGGTTGAACTCGAGTTCAACCAGATTTCAAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1890s1c1
Sequence:CCGGCCGGATAAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTTATCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3703s1c1
Sequence:CCGGCGAGACTTACACTCAAGCAATCTCGAGATTGCTTGAGTGTAAGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002465.2-3691s1c1
Sequence:CCGGGATTCGTATCTGCGAGACTTACTCGAGTAAGTCTCGCAGATACGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-1889s1c1
Sequence:CCGGGCCGGATAAGAACAGAATCTTCTCGAGAAGATTCTGTTCTTATCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-2856s1c1
Sequence:CCGGGCAAGTCAAAGTGGACAAATTCTCGAGAATTTGTCCACTTTGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002465.2-3229s1c1
Sequence:CCGGCCAGTGTATGAAGACTTTGATCTCGAGATCAAAGTCTTCATACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)