EMAIL THIS PAGE TO A FRIEND

MYBPC2

myosin binding protein C, fast type

57 Gene Product Result for
Synonyms: MYBPC MYBPCF
UniProtKB ID: Q14324, A1L4G9
Gene ID:
Human(4606) Summary: This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]
Mouse(233199) myosin binding protein C, fast-type
Rat(292879) myosin binding protein C, fast-type
domestic guinea pig(100719852) myosin binding protein C, fast type
naked mole-rat(101697833) myosin binding protein C, fast type
sheep(101111044) myosin binding protein C, fast type
chicken(425457) myosin binding protein C, fast type
cow(520988) myosin binding protein C, fast type
domestic cat(101085006) myosin binding protein C, fast type
dog(476404) myosin binding protein C, fast type
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004533 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040971 MISSION® esiRNA esiRNA human MYBPC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004533 Rosetta Predictions human pricing
NM_001106257 Rosetta Predictions rat pricing
NM_146189 Rosetta Predictions mouse pricing
NM_178067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030529 predicted 3031
2 SASI_Hs01_00030530 predicted 1660
3 SASI_Hs01_00030531 predicted 2132
4 SASI_Hs01_00030532 predicted 3070
5 SASI_Hs01_00030533 predicted 3138
6 SASI_Hs01_00030534 predicted 1177
7 SASI_Hs01_00030535 predicted 853
8 SASI_Hs02_00337839 predicted 3184
9 SASI_Hs01_00030536 predicted 1508
10 SASI_Hs01_00030537 predicted 2107
11 SASI_Hs01_00030538 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217188 predicted 2101
2 SASI_Rn02_00217189 predicted 3368
3 SASI_Rn02_00217190 predicted 1071
4 SASI_Rn02_00217191 predicted 3209
5 SASI_Rn02_00217192 predicted 1939
6 SASI_Rn02_00217193 predicted 2818
7 SASI_Rn02_00217194 predicted 1469
8 SASI_Rn02_00217195 predicted 913
9 SASI_Rn02_00217196 predicted 1619
10 SASI_Rn02_00217197 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154427 predicted 3145
2 SASI_Mm01_00154428 predicted 1228
3 SASI_Mm01_00154429 predicted 364
4 SASI_Mm01_00154430 predicted 1236
5 SASI_Mm01_00154431 predicted 354
6 SASI_Mm01_00154432 predicted 356
7 SASI_Mm01_00154433 predicted 1215
8 SASI_Mm01_00154434 predicted 1218
9 SASI_Mm01_00154435 predicted 224
10 SASI_Mm01_00154436 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148424 predicted 3159
2 SASI_Mm01_00148425 predicted 1246
3 SASI_Mm01_00148426 predicted 379
4 SASI_Mm01_00148427 predicted 1243
5 SASI_Mm01_00148428 predicted 367
6 SASI_Mm01_00148429 predicted 371
7 SASI_Mm01_00148430 predicted 1232
8 SASI_Mm01_00148431 predicted 1229
9 SASI_Mm01_00148432 predicted 245
10 SASI_Mm01_00148433 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146189
MYBPC2 MISSION shRNA Bacterial Glycerol Stock
myosin binding protein C, fast type
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-1155s1c1
Sequence:CCGGGCACAGGTTATGTGGATGAAACTCGAGTTTCATCCACATAACCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-2566s1c1
Sequence:CCGGGCCATCTTCGTCAGACTTATACTCGAGTATAAGTCTGACGAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-343s1c1
Sequence:CCGGCCCGGTTCATCTTCAAGGAATCTCGAGATTCCTTGAAGATGAACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-3044s1c1
Sequence:CCGGCTTCCGTATCTTCAGCGAGAACTCGAGTTCTCGCTGAAGATACGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-3047s1c1
Sequence:CCGGCCGTATCTTCAGCGAGAACATCTCGAGATGTTCTCGCTGAAGATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-2141s21c1
Sequence:CCGGGATGATCGAGGGCGTCCTTTACTCGAGTAAAGGACGCCCTCGATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-3119s21c1
Sequence:CCGGCAAGACAGGAATCACCTTAAACTCGAGTTTAAGGTGATTCCTGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-658s21c1
Sequence:CCGGTGGGTATACCTCCGGAGATTTCTCGAGAAATCTCCGGAGGTATACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146189
MYBPC2 MISSION shRNA shRNA Plasmid DNA
myosin binding protein C, fast type
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-1155s1c1
Sequence:CCGGGCACAGGTTATGTGGATGAAACTCGAGTTTCATCCACATAACCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-2566s1c1
Sequence:CCGGGCCATCTTCGTCAGACTTATACTCGAGTATAAGTCTGACGAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-343s1c1
Sequence:CCGGCCCGGTTCATCTTCAAGGAATCTCGAGATTCCTTGAAGATGAACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-3044s1c1
Sequence:CCGGCTTCCGTATCTTCAGCGAGAACTCGAGTTCTCGCTGAAGATACGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-3047s1c1
Sequence:CCGGCCGTATCTTCAGCGAGAACATCTCGAGATGTTCTCGCTGAAGATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-2141s21c1
Sequence:CCGGGATGATCGAGGGCGTCCTTTACTCGAGTAAAGGACGCCCTCGATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-3119s21c1
Sequence:CCGGCAAGACAGGAATCACCTTAAACTCGAGTTTAAGGTGATTCCTGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-658s21c1
Sequence:CCGGTGGGTATACCTCCGGAGATTTCTCGAGAAATCTCCGGAGGTATACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146189
MYBPC2 MISSION shRNA Lentiviral Transduction Particles
myosin binding protein C, fast type
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-1155s1c1
Sequence:CCGGGCACAGGTTATGTGGATGAAACTCGAGTTTCATCCACATAACCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-2566s1c1
Sequence:CCGGGCCATCTTCGTCAGACTTATACTCGAGTATAAGTCTGACGAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-343s1c1
Sequence:CCGGCCCGGTTCATCTTCAAGGAATCTCGAGATTCCTTGAAGATGAACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-3044s1c1
Sequence:CCGGCTTCCGTATCTTCAGCGAGAACTCGAGTTCTCGCTGAAGATACGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146189.1-3047s1c1
Sequence:CCGGCCGTATCTTCAGCGAGAACATCTCGAGATGTTCTCGCTGAAGATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-2141s21c1
Sequence:CCGGGATGATCGAGGGCGTCCTTTACTCGAGTAAAGGACGCCCTCGATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-3119s21c1
Sequence:CCGGCAAGACAGGAATCACCTTAAACTCGAGTTTAAGGTGATTCCTGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146189.1-658s21c1
Sequence:CCGGTGGGTATACCTCCGGAGATTTCTCGAGAAATCTCCGGAGGTATACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004533
MYBPC2 MISSION shRNA Bacterial Glycerol Stock
myosin binding protein C, fast type
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1631s1c1
Sequence:CCGGCCACCAAAGATCCACTTGGATCTCGAGATCCAAGTGGATCTTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-3031s1c1
Sequence:CCGGCCGAGTTTACACCGAGAACATCTCGAGATGTTCTCGGTGTAAACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1818s1c1
Sequence:CCGGGCAGCAGCTTTGTGATTGAGACTCGAGTCTCAATCACAAAGCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1529s1c1
Sequence:CCGGGATGAGGGAGACTACACGTTTCTCGAGAAACGTGTAGTCTCCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-505s1c1
Sequence:CCGGGCAGAGTCTAGAAAGCTTCAACTCGAGTTGAAGCTTTCTAGACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-911s1c1
Sequence:CCGGCCAAGCAGCAAGTACGTGTTTCTCGAGAAACACGTACTTGCTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-3010s1c1
Sequence:CCGGCGTGGGCAATGAATACTATTTCTCGAGAAATAGTATTCATTGCCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004533
MYBPC2 MISSION shRNA shRNA Plasmid DNA
myosin binding protein C, fast type
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1631s1c1
Sequence:CCGGCCACCAAAGATCCACTTGGATCTCGAGATCCAAGTGGATCTTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-3031s1c1
Sequence:CCGGCCGAGTTTACACCGAGAACATCTCGAGATGTTCTCGGTGTAAACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1818s1c1
Sequence:CCGGGCAGCAGCTTTGTGATTGAGACTCGAGTCTCAATCACAAAGCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1529s1c1
Sequence:CCGGGATGAGGGAGACTACACGTTTCTCGAGAAACGTGTAGTCTCCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-505s1c1
Sequence:CCGGGCAGAGTCTAGAAAGCTTCAACTCGAGTTGAAGCTTTCTAGACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-911s1c1
Sequence:CCGGCCAAGCAGCAAGTACGTGTTTCTCGAGAAACACGTACTTGCTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-3010s1c1
Sequence:CCGGCGTGGGCAATGAATACTATTTCTCGAGAAATAGTATTCATTGCCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004533
MYBPC2 MISSION shRNA Lentiviral Transduction Particles
myosin binding protein C, fast type
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1631s1c1
Sequence:CCGGCCACCAAAGATCCACTTGGATCTCGAGATCCAAGTGGATCTTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-3031s1c1
Sequence:CCGGCCGAGTTTACACCGAGAACATCTCGAGATGTTCTCGGTGTAAACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1818s1c1
Sequence:CCGGGCAGCAGCTTTGTGATTGAGACTCGAGTCTCAATCACAAAGCTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-1529s1c1
Sequence:CCGGGATGAGGGAGACTACACGTTTCTCGAGAAACGTGTAGTCTCCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-505s1c1
Sequence:CCGGGCAGAGTCTAGAAAGCTTCAACTCGAGTTGAAGCTTTCTAGACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-911s1c1
Sequence:CCGGCCAAGCAGCAAGTACGTGTTTCTCGAGAAACACGTACTTGCTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004533.2-3010s1c1
Sequence:CCGGCGTGGGCAATGAATACTATTTCTCGAGAAATAGTATTCATTGCCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)