EMAIL THIS PAGE TO A FRIEND

MYBPC3

myosin binding protein C, cardiac

60 Gene Product Result for
Synonyms: CMD1MM CMH4 FHC LVNC10 MYBP-C
UniProtKB ID: Q14896, A5PL00, Q16410, Q6R2F7, Q9UE27, Q9UM53
Gene ID:
Human(4607) Summary: MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Mouse(17868) myosin binding protein C, cardiac
Rat(295929) myosin binding protein C, cardiac
Zebrafish(556489) myosin binding protein C, cardiac
chicken(396013) myosin binding protein C, cardiac
dog(483624) myosin binding protein C, cardiac
domestic cat(100105196) myosin binding protein C, cardiac
domestic cat(101094698) myosin binding protein C, cardiac
cow(767614) myosin binding protein C, cardiac
sheep(101119505) myosin binding protein C, cardiac
naked mole-rat(101708550) myosin binding protein C, cardiac
domestic guinea pig(100726817) myosin binding protein C, cardiac
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0739 AQUA Peptide IAFQYGVTDL[R] human pricing
AQ0738 AQUA Peptide NSPTDTILFI[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000256 Rosetta Predictions human pricing
NM_001106490 Rosetta Predictions rat pricing
NM_008653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137904 predicted 3477
2 SASI_Hs01_00137905 predicted 2830
3 SASI_Hs01_00137906 predicted 3547
4 SASI_Hs02_00302185 predicted 3190
5 SASI_Hs01_00137908 predicted 3544
6 SASI_Hs01_00137909 predicted 3965
7 SASI_Hs01_00137910 predicted 291
8 SASI_Hs01_00137911 predicted 2290
9 SASI_Hs01_00137912 predicted 2539
10 SASI_Hs02_00302186 predicted 1262
11 SASI_Hs01_00137907 predicted 1923
12 SASI_Hs01_00137913 predicted 3438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219478 predicted 2542
2 SASI_Rn02_00219479 predicted 3517
3 SASI_Rn02_00219480 predicted 1801
4 SASI_Rn02_00219481 predicted 1234
5 SASI_Rn02_00219482 predicted 1716
6 SASI_Rn02_00219483 predicted 966
7 SASI_Rn02_00219484 predicted 3403
8 SASI_Rn02_00219485 predicted 2269
9 SASI_Rn02_00219486 predicted 414
10 SASI_Rn02_00219487 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314405 predicted 1874
2 SASI_Mm01_00066057 predicted 1556
3 SASI_Mm02_00314406 predicted 2815
4 SASI_Mm01_00066059 predicted 1813
5 SASI_Mm01_00066060 predicted 3409
6 SASI_Mm01_00066061 predicted 2549
7 SASI_Mm01_00066062 predicted 3532
8 SASI_Mm01_00066063 predicted 1722
9 SASI_Mm01_00066064 predicted 3797
10 SASI_Mm01_00066065 predicted 1835
11 SASI_Mm01_00066058 predicted 2873
12 SASI_Mm01_00066066 predicted 2065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000256
MYBPC3 MISSION shRNA Bacterial Glycerol Stock
myosin binding protein C, cardiac
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000256.3-3515s21c1
Sequence:CCGGACCAAGGAGCCCGTCTTTATCCTCGAGGATAAAGACGGGCTCCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000256.3-3391s21c1
Sequence:CCGGGTTCACCGTCTTGGAGCATTACTCGAGTAATGCTCCAAGACGGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000256.2-3938s1c1
Sequence:CCGGCCTCCCTACTGTTGGATGTATCTCGAGATACATCCAACAGTAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-3453s1c1
Sequence:CCGGAGCCAGAATATGGTTGGCTTTCTCGAGAAAGCCAACCATATTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-1919s1c1
Sequence:CCGGCCACTTCATGGAGGTCAAGATCTCGAGATCTTGACCTCCATGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-258s1c1
Sequence:CCGGCAGGGATCTTACGCAGTCATTCTCGAGAATGACTGCGTAAGATCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-3454s1c1
Sequence:CCGGGCCAGAATATGGTTGGCTTTACTCGAGTAAAGCCAACCATATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000256
MYBPC3 MISSION shRNA shRNA Plasmid DNA
myosin binding protein C, cardiac
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000256.3-3515s21c1
Sequence:CCGGACCAAGGAGCCCGTCTTTATCCTCGAGGATAAAGACGGGCTCCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000256.3-3391s21c1
Sequence:CCGGGTTCACCGTCTTGGAGCATTACTCGAGTAATGCTCCAAGACGGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000256.2-3938s1c1
Sequence:CCGGCCTCCCTACTGTTGGATGTATCTCGAGATACATCCAACAGTAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-3453s1c1
Sequence:CCGGAGCCAGAATATGGTTGGCTTTCTCGAGAAAGCCAACCATATTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-1919s1c1
Sequence:CCGGCCACTTCATGGAGGTCAAGATCTCGAGATCTTGACCTCCATGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-258s1c1
Sequence:CCGGCAGGGATCTTACGCAGTCATTCTCGAGAATGACTGCGTAAGATCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-3454s1c1
Sequence:CCGGGCCAGAATATGGTTGGCTTTACTCGAGTAAAGCCAACCATATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000256
MYBPC3 MISSION shRNA Lentiviral Transduction Particles
myosin binding protein C, cardiac
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000256.3-3515s21c1
Sequence:CCGGACCAAGGAGCCCGTCTTTATCCTCGAGGATAAAGACGGGCTCCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000256.3-3391s21c1
Sequence:CCGGGTTCACCGTCTTGGAGCATTACTCGAGTAATGCTCCAAGACGGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000256.2-3938s1c1
Sequence:CCGGCCTCCCTACTGTTGGATGTATCTCGAGATACATCCAACAGTAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-3453s1c1
Sequence:CCGGAGCCAGAATATGGTTGGCTTTCTCGAGAAAGCCAACCATATTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-1919s1c1
Sequence:CCGGCCACTTCATGGAGGTCAAGATCTCGAGATCTTGACCTCCATGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-258s1c1
Sequence:CCGGCAGGGATCTTACGCAGTCATTCTCGAGAATGACTGCGTAAGATCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000256.2-3454s1c1
Sequence:CCGGGCCAGAATATGGTTGGCTTTACTCGAGTAAAGCCAACCATATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008653
MYBPC3 MISSION shRNA Bacterial Glycerol Stock
myosin binding protein C, cardiac
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008653.1-4011s1c1
Sequence:CCGGCTACTGCATGTGTGTGTGCAACTCGAGTTGCACACACACATGCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-258s1c1
Sequence:CCGGCGCCAATGACAAGTATGGTTTCTCGAGAAACCATACTTGTCATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-1083s1c1
Sequence:CCGGGCCATCAGAATATGAGCGCATCTCGAGATGCGCTCATATTCTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-3665s1c1
Sequence:CCGGGCTCCATCATTGCAGGCTATACTCGAGTATAGCCTGCAATGATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-1861s1c1
Sequence:CCGGCGCATAAAGGTGTCCCATATACTCGAGTATATGGGACACCTTTATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008653
MYBPC3 MISSION shRNA shRNA Plasmid DNA
myosin binding protein C, cardiac
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008653.1-4011s1c1
Sequence:CCGGCTACTGCATGTGTGTGTGCAACTCGAGTTGCACACACACATGCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-258s1c1
Sequence:CCGGCGCCAATGACAAGTATGGTTTCTCGAGAAACCATACTTGTCATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-1083s1c1
Sequence:CCGGGCCATCAGAATATGAGCGCATCTCGAGATGCGCTCATATTCTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-3665s1c1
Sequence:CCGGGCTCCATCATTGCAGGCTATACTCGAGTATAGCCTGCAATGATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-1861s1c1
Sequence:CCGGCGCATAAAGGTGTCCCATATACTCGAGTATATGGGACACCTTTATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008653
MYBPC3 MISSION shRNA Lentiviral Transduction Particles
myosin binding protein C, cardiac
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008653.1-4011s1c1
Sequence:CCGGCTACTGCATGTGTGTGTGCAACTCGAGTTGCACACACACATGCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-258s1c1
Sequence:CCGGCGCCAATGACAAGTATGGTTTCTCGAGAAACCATACTTGTCATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-1083s1c1
Sequence:CCGGGCCATCAGAATATGAGCGCATCTCGAGATGCGCTCATATTCTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-3665s1c1
Sequence:CCGGGCTCCATCATTGCAGGCTATACTCGAGTATAGCCTGCAATGATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008653.1-1861s1c1
Sequence:CCGGCGCATAAAGGTGTCCCATATACTCGAGTATATGGGACACCTTTATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)