EMAIL THIS PAGE TO A FRIEND

MYBPH

myosin binding protein H

55 Gene Product Result for
UniProtKB ID: Q13203, Q16886, Q86YC5
Gene ID:
Mouse(53311) myosin binding protein H
Rat(83708) myosin binding protein H
domestic guinea pig(100722005) myosin binding protein H
naked mole-rat(101705987) myosin binding protein H
sheep(101110254) myosin binding protein H
chicken(421154) myosin binding protein H
domestic cat(101081437) myosin binding protein H
cow(510169) myosin binding protein H
Horse(100065224) myosin binding protein H
dog(490223) myosin binding protein H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004997 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004997 Rosetta Predictions human pricing
NM_031813 Rosetta Predictions rat pricing
NM_016749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026683 predicted 1171
2 SASI_Hs01_00026684 predicted 1267
3 SASI_Hs01_00026685 predicted 1156
4 SASI_Hs01_00026686 predicted 1407
5 SASI_Hs01_00026687 predicted 888
6 SASI_Hs01_00026688 predicted 1061
7 SASI_Hs01_00026689 predicted 1153
8 SASI_Hs01_00026691 predicted 864
9 SASI_Hs02_00338734 predicted 1027
10 SASI_Hs02_00338735 predicted 1558
11 SASI_Hs01_00026682 predicted 624
12 SASI_Hs01_00026690 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086306 predicted 1426
2 SASI_Rn01_00086307 predicted 959
3 SASI_Rn01_00086309 predicted 1381
4 SASI_Rn01_00086310 predicted 1007
5 SASI_Rn01_00086311 predicted 836
6 SASI_Rn02_00265271 predicted 598
7 SASI_Rn01_00086313 predicted 368
8 SASI_Rn02_00265272 predicted 1393
9 SASI_Rn02_00265273 predicted 672
10 SASI_Rn02_00265274 predicted 741
11 SASI_Rn01_00086305 predicted 804
12 SASI_Rn01_00086308 predicted 1095
13 SASI_Rn01_00086312 predicted 1141
14 SASI_Rn01_00086314 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064164 predicted 632
2 SASI_Mm01_00064165 predicted 796
3 SASI_Mm01_00064166 predicted 318
4 SASI_Mm01_00064167 predicted 844
5 SASI_Mm01_00064168 predicted 1049
6 SASI_Mm01_00064169 predicted 1288
7 SASI_Mm01_00064171 predicted 694
8 SASI_Mm01_00064172 predicted 411
9 SASI_Mm01_00064173 predicted 436
10 SASI_Mm02_00323482 predicted 709
11 SASI_Mm01_00064170 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004997
MYBPH MISSION shRNA Bacterial Glycerol Stock
myosin binding protein H
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1161s1c1
Sequence:CCGGGCCAAACCTAAAGGGTTTATTCTCGAGAATAAACCCTTTAGGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1412s1c1
Sequence:CCGGCTACACCTGCAAGGCCATAAACTCGAGTTTATGGCCTTGCAGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004997.2-1560s1c1
Sequence:CCGGCTACAGTCAAACTCCAGAGATCTCGAGATCTCTGGAGTTTGACTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-147s1c1
Sequence:CCGGCCCGGAGAAGTGGCAGTATCACTCGAGTGATACTGCCACTTCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1290s1c1
Sequence:CCGGCCCAAGATCATCTGGATGAAACTCGAGTTTCATCCAGATGATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004997.2-1368s21c1
Sequence:CCGGTGCACCCTAGAGATCCGGAAACTCGAGTTTCCGGATCTCTAGGGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004997
MYBPH MISSION shRNA shRNA Plasmid DNA
myosin binding protein H
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1161s1c1
Sequence:CCGGGCCAAACCTAAAGGGTTTATTCTCGAGAATAAACCCTTTAGGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1412s1c1
Sequence:CCGGCTACACCTGCAAGGCCATAAACTCGAGTTTATGGCCTTGCAGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004997.2-1560s1c1
Sequence:CCGGCTACAGTCAAACTCCAGAGATCTCGAGATCTCTGGAGTTTGACTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-147s1c1
Sequence:CCGGCCCGGAGAAGTGGCAGTATCACTCGAGTGATACTGCCACTTCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1290s1c1
Sequence:CCGGCCCAAGATCATCTGGATGAAACTCGAGTTTCATCCAGATGATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004997.2-1368s21c1
Sequence:CCGGTGCACCCTAGAGATCCGGAAACTCGAGTTTCCGGATCTCTAGGGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004997
MYBPH MISSION shRNA Lentiviral Transduction Particles
myosin binding protein H
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1161s1c1
Sequence:CCGGGCCAAACCTAAAGGGTTTATTCTCGAGAATAAACCCTTTAGGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1412s1c1
Sequence:CCGGCTACACCTGCAAGGCCATAAACTCGAGTTTATGGCCTTGCAGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004997.2-1560s1c1
Sequence:CCGGCTACAGTCAAACTCCAGAGATCTCGAGATCTCTGGAGTTTGACTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-147s1c1
Sequence:CCGGCCCGGAGAAGTGGCAGTATCACTCGAGTGATACTGCCACTTCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004997.2-1290s1c1
Sequence:CCGGCCCAAGATCATCTGGATGAAACTCGAGTTTCATCCAGATGATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004997.2-1368s21c1
Sequence:CCGGTGCACCCTAGAGATCCGGAAACTCGAGTTTCCGGATCTCTAGGGTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016749
MYBPH MISSION shRNA Bacterial Glycerol Stock
myosin binding protein H
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000090223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016749.2-1623s1c1
Sequence:CCGGCAAGACCATAGGAACAGCGAACTCGAGTTCGCTGTTCCTATGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-1152s1c1
Sequence:CCGGCACATCCACAAGGCAGATATTCTCGAGAATATCTGCCTTGTGGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-564s1c1
Sequence:CCGGCACATCCAAGAGATCACTGAACTCGAGTTCAGTGATCTCTTGGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-1067s1c1
Sequence:CCGGCATTGGCAACTCGTACTCTTTCTCGAGAAAGAGTACGAGTTGCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016749
MYBPH MISSION shRNA shRNA Plasmid DNA
myosin binding protein H
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000090223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016749.2-1623s1c1
Sequence:CCGGCAAGACCATAGGAACAGCGAACTCGAGTTCGCTGTTCCTATGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-1152s1c1
Sequence:CCGGCACATCCACAAGGCAGATATTCTCGAGAATATCTGCCTTGTGGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-564s1c1
Sequence:CCGGCACATCCAAGAGATCACTGAACTCGAGTTCAGTGATCTCTTGGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-1067s1c1
Sequence:CCGGCATTGGCAACTCGTACTCTTTCTCGAGAAAGAGTACGAGTTGCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016749
MYBPH MISSION shRNA Lentiviral Transduction Particles
myosin binding protein H
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000090223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016749.2-1623s1c1
Sequence:CCGGCAAGACCATAGGAACAGCGAACTCGAGTTCGCTGTTCCTATGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-1152s1c1
Sequence:CCGGCACATCCACAAGGCAGATATTCTCGAGAATATCTGCCTTGTGGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-564s1c1
Sequence:CCGGCACATCCAAGAGATCACTGAACTCGAGTTCAGTGATCTCTTGGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016749.2-1067s1c1
Sequence:CCGGCATTGGCAACTCGTACTCTTTCTCGAGAAAGAGTACGAGTTGCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)