EMAIL THIS PAGE TO A FRIEND

MYBPHL

myosin binding protein H-like

48 Gene Product Result for
UniProtKB ID: A2RUH7, Q5T2Z7
Gene ID:
Human(343263) Summary: This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Mouse(68753) myosin binding protein H-like
Rat(310782) myosin binding protein H-like
domestic cat(101089951) myosin binding protein H-like
Horse(100061349) myosin binding protein H-like
dog(611839) myosin binding protein H-like
cow(538875) myosin binding protein H-like
sheep(101104282) myosin binding protein H-like
naked mole-rat(101697268) myosin binding protein H-like
Domestic Rabbit(100341020) myosin binding protein H-like
domestic guinea pig(100717987) myosin binding protein H-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103862 Anti-MYBPHL (247-258) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1302811 ANTI-MYBPHL (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010985 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_131077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_131077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_131077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010985 Rosetta Predictions human pricing
NM_001014042 Rosetta Predictions rat pricing
NM_026831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147072 predicted 947
2 SASI_Hs01_00147073 predicted 522
3 SASI_Hs01_00147074 predicted 1131
4 SASI_Hs01_00147075 predicted 773
5 SASI_Hs01_00147076 predicted 1114
6 SASI_Hs01_00147077 predicted 249
7 SASI_Hs01_00147078 predicted 492
8 SASI_Hs01_00147079 predicted 982
9 SASI_Hs01_00147080 predicted 1115
10 SASI_Hs01_00147081 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047857 predicted 990
2 SASI_Rn01_00047858 predicted 370
3 SASI_Rn02_00201431 predicted 741
4 SASI_Rn01_00047860 predicted 525
5 SASI_Rn02_00201432 predicted 326
6 SASI_Rn01_00047863 predicted 762
7 SASI_Rn01_00047864 predicted 487
8 SASI_Rn01_00047865 predicted 937
9 SASI_Rn01_00047866 predicted 303
10 SASI_Rn02_00201433 predicted 776
11 SASI_Rn01_00047859 predicted 578
12 SASI_Rn01_00047861 predicted 338
13 SASI_Rn01_00047862 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046144 predicted 393
2 SASI_Mm01_00046145 predicted 258
3 SASI_Mm01_00046146 predicted 893
4 SASI_Mm01_00046148 predicted 705
5 SASI_Mm01_00046149 predicted 535
6 SASI_Mm01_00046150 predicted 335
7 SASI_Mm01_00046151 predicted 817
8 SASI_Mm01_00046152 predicted 289
9 SASI_Mm01_00046153 predicted 756
10 SASI_Mm02_00331003 predicted 690
11 SASI_Mm01_00046147 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010985
MYBPHL MISSION shRNA Bacterial Glycerol Stock
myosin binding protein H-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010985.2-1128s21c1
Sequence:CCGGAGGCATGGTACTCTGACAAAGCTCGAGCTTTGTCAGAGTACCATGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010985.2-1106s21c1
Sequence:CCGGTCCTAATTGAGGACACCTAAGCTCGAGCTTAGGTGTCCTCAATTAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-1024s1c1
Sequence:CCGGCCTTTGATGGAGGCATCTATACTCGAGTATAGATGCCTCCATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-259s1c1
Sequence:CCGGCAGTGAACCTACTAATCCCATCTCGAGATGGGATTAGTAGGTTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-773s1c1
Sequence:CCGGGAAAGCAGCTACTGTTTACAACTCGAGTTGTAAACAGTAGCTGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-872s1c1
Sequence:CCGGCGGCTATAATACCCAGCTCTTCTCGAGAAGAGCTGGGTATTATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010985.1-1156s1c1
Sequence:CCGGCCAGCAATGAAGTGAATTCATCTCGAGATGAATTCACTTCATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010985
MYBPHL MISSION shRNA shRNA Plasmid DNA
myosin binding protein H-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010985.2-1128s21c1
Sequence:CCGGAGGCATGGTACTCTGACAAAGCTCGAGCTTTGTCAGAGTACCATGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010985.2-1106s21c1
Sequence:CCGGTCCTAATTGAGGACACCTAAGCTCGAGCTTAGGTGTCCTCAATTAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-1024s1c1
Sequence:CCGGCCTTTGATGGAGGCATCTATACTCGAGTATAGATGCCTCCATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-259s1c1
Sequence:CCGGCAGTGAACCTACTAATCCCATCTCGAGATGGGATTAGTAGGTTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-773s1c1
Sequence:CCGGGAAAGCAGCTACTGTTTACAACTCGAGTTGTAAACAGTAGCTGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-872s1c1
Sequence:CCGGCGGCTATAATACCCAGCTCTTCTCGAGAAGAGCTGGGTATTATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010985.1-1156s1c1
Sequence:CCGGCCAGCAATGAAGTGAATTCATCTCGAGATGAATTCACTTCATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010985
MYBPHL MISSION shRNA Lentiviral Transduction Particles
myosin binding protein H-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010985.2-1128s21c1
Sequence:CCGGAGGCATGGTACTCTGACAAAGCTCGAGCTTTGTCAGAGTACCATGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010985.2-1106s21c1
Sequence:CCGGTCCTAATTGAGGACACCTAAGCTCGAGCTTAGGTGTCCTCAATTAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-1024s1c1
Sequence:CCGGCCTTTGATGGAGGCATCTATACTCGAGTATAGATGCCTCCATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-259s1c1
Sequence:CCGGCAGTGAACCTACTAATCCCATCTCGAGATGGGATTAGTAGGTTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-773s1c1
Sequence:CCGGGAAAGCAGCTACTGTTTACAACTCGAGTTGTAAACAGTAGCTGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010985.1-872s1c1
Sequence:CCGGCGGCTATAATACCCAGCTCTTCTCGAGAAGAGCTGGGTATTATAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010985.1-1156s1c1
Sequence:CCGGCCAGCAATGAAGTGAATTCATCTCGAGATGAATTCACTTCATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_131077
MYBPHL MISSION shRNA Bacterial Glycerol Stock
myosin binding protein H-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-530s1c1
Sequence:CCGGCCCTCCTCAGAGTATTAAGTTCTCGAGAACTTAATACTCTGAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-541s1c1
Sequence:CCGGGTATTAAGTTGGTGGACGTTTCTCGAGAAACGTCCACCAACTTAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-594s1c1
Sequence:CCGGCCACAAGATACGGGCAATACACTCGAGTGTATTGCCCGTATCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-959s1c1
Sequence:CCGGCAAGATCATCTGGCTAAAGAACTCGAGTTCTTTAGCCAGATGATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-592s1c1
Sequence:CCGGCTCCACAAGATACGGGCAATACTCGAGTATTGCCCGTATCTTGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_131077
MYBPHL MISSION shRNA shRNA Plasmid DNA
myosin binding protein H-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-530s1c1
Sequence:CCGGCCCTCCTCAGAGTATTAAGTTCTCGAGAACTTAATACTCTGAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-541s1c1
Sequence:CCGGGTATTAAGTTGGTGGACGTTTCTCGAGAAACGTCCACCAACTTAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-594s1c1
Sequence:CCGGCCACAAGATACGGGCAATACACTCGAGTGTATTGCCCGTATCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-959s1c1
Sequence:CCGGCAAGATCATCTGGCTAAAGAACTCGAGTTCTTTAGCCAGATGATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-592s1c1
Sequence:CCGGCTCCACAAGATACGGGCAATACTCGAGTATTGCCCGTATCTTGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_131077
MYBPHL MISSION shRNA Lentiviral Transduction Particles
myosin binding protein H-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-530s1c1
Sequence:CCGGCCCTCCTCAGAGTATTAAGTTCTCGAGAACTTAATACTCTGAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-541s1c1
Sequence:CCGGGTATTAAGTTGGTGGACGTTTCTCGAGAAACGTCCACCAACTTAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-594s1c1
Sequence:CCGGCCACAAGATACGGGCAATACACTCGAGTGTATTGCCCGTATCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-959s1c1
Sequence:CCGGCAAGATCATCTGGCTAAAGAACTCGAGTTCTTTAGCCAGATGATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131077.2-592s1c1
Sequence:CCGGCTCCACAAGATACGGGCAATACTCGAGTATTGCCCGTATCTTGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)