EMAIL THIS PAGE TO A FRIEND

MYC

v-myc avian myelocytomatosis viral oncogene homolog

117 Gene Product Result for
Synonyms: MRTL MYCC bHLHe39 c-Myc
UniProtKB ID: P01106, A8WFE7, P01107, Q14026
Gene ID:
Human(4609) Summary: The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. It functions as a transcription factor that regulates transcription of specific target genes. Mutations, overexpression, rearrangement and translocation of this gene have been associated with a variety of hematopoietic tumors, leukemias and lymphomas, including Burkitt lymphoma. There is evidence to show that alternative translation initiations from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site result in the production of two isoforms with distinct N-termini. The synthesis of non-AUG initiated protein is suppressed in Burkitt's lymphomas, suggesting its importance in the normal function of this gene. [provided by RefSeq, Jul 2008]
Mouse(17869) myelocytomatosis oncogene
Rat(24577) myelocytomatosis oncogene
chicken(420332) v-myc myelocytomatosis viral oncogene homolog
dog(403924) v-myc myelocytomatosis viral oncogene homolog (avian)
domestic cat(100379628) v-myc myelocytomatosis viral oncogene homolog (avian)
cow(511077) v-myc myelocytomatosis viral oncogene homolog (avian)
domestic guinea pig(100724557) v-myc myelocytomatosis viral oncogene homolog (avian)
Domestic Rabbit(100327265) v-myc myelocytomatosis viral oncogene homolog (avian)
sheep(443447) v-myc myelocytomatosis viral oncogene homolog (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21184P Anti-c-Myc (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
GW21222 Anti-c-Myc (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
A7470 Anti-c-Myc Agarose Affinity Gel antibody produced in rabbit affinity isolated antibody human
affinity chromatography, immunoprecipitation (IP) pricing
C3956 Anti-c-Myc antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunocytochemistry, immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
A5963 Anti-c-Myc−Alkaline Phosphatase antibody, Mouse monoclonal clone 9E10, purified from hybridoma cell culture human
ELISA, immunohistochemistry, western blot pricing
A5598 Anti-c-Myc−Peroxidase antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2108476 Anti-MYC affinity isolated antibody rat, guinea pig, rabbit, mouse, human
immunohistochemistry, western blot pricing
SAB4300319 Anti-MYC (Ab-358) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300320 Anti-MYC (Ab-373) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4300318 Anti-MYC (Ab-58) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
AV04001 Anti-MyC (AB1) antibody produced in rabbit affinity isolated antibody mouse, dog, human, rat
western blot pricing
AV32708 Anti-MyC (AB2) antibody produced in rabbit affinity isolated antibody horse, mouse, sheep, rabbit, guinea pig, human, rat, rabbit
immunohistochemistry, western blot pricing
AV38157 Anti-MyC (AB3) antibody produced in rabbit affinity isolated antibody mouse, human, pig, rat
western blot pricing
AV38156 Anti-MyC antibody produced in rabbit IgG fraction of antiserum rabbit, human, rat, pig
immunohistochemistry, western blot pricing
SAB4501941 Anti-MYC antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4503660 Anti-MYC antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503661 Anti-MYC antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503662 Anti-MYC antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503663 Anti-MYC antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
HPA055893 Anti-MYC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA066556 Anti-MYC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2103448 Anti-MYC, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, sheep, human, bovine, dog, guinea pig, horse
western blot pricing
M8433 Anti-phospho-c-Myc (pThr58/pSer62) antibody produced in rabbit affinity isolated antibody, liquid human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4300026 Anti-phospho-MYC (pSer373) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4503771 Anti-phospho-Myc (pSer62) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300243 Anti-phospho-MYC (pSer62) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence pricing
SAB4504477 Anti-phospho-Myc (pThr358) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4300025 Anti-phospho-MYC (pThr358) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504478 Anti-phospho-Myc (pThr58) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300024 Anti-phospho-MYC (pThr58) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB3300002 Monoclonal Anti-c-Myc antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
M4439 Monoclonal Anti-c-Myc antibody produced in mouse clone 9E10, purified immunoglobulin, buffered aqueous solution human
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB3300003 Monoclonal Anti-c-Myc antibody produced in mouse clone 3F2, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
SAB3300004 Monoclonal Anti-c-Myc antibody produced in mouse clone 5G3, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
M5546 Monoclonal Anti-c-Myc antibody produced in mouse clone 9E10, ascites fluid human
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
B7554 Monoclonal Anti-c-Myc−Biotin antibody produced in mouse clone 9E10, purified immunoglobulin, buffered aqueous solution human
western blot pricing
C6594 Monoclonal Anti-c-Myc−Cy3 antibody produced in mouse clone 9E10, purified immunoglobulin, buffered aqueous solution human
immunofluorescence pricing
F2047 Monoclonal Anti-c-Myc−FITC antibody produced in mouse clone 9E10, purified immunoglobulin, buffered aqueous solution human
immunocytochemistry pricing
SAB4700447 Monoclonal Anti-MYC , (C-terminal) antibody produced in mouse clone 9E10, purified immunoglobulin, buffered aqueous solution human, fusion proteins in all species
flow cytometry pricing
WH0004609M2 Monoclonal Anti-MYC antibody produced in mouse clone 1G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4700448 Monoclonal Anti-MYC-FITC , (C-terminal) antibody produced in mouse clone 9E10, purified immunoglobulin, buffered aqueous solution fusion proteins in all species, human
flow cytometry pricing
PLA0001 Rabbit anti-c-myc Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
ELISA, immunocytochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1379 Human c-Myc ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
ABE25 Anti-acetyl-c-Myc (Lys148) Antibody Use Anti-acetyl-c-Myc (Lys148) Antibody (Rabbit Polyclonal Antibody) validated in WB to detect acetyl-c-Myc (Lys148) also known as HLHe39, Proto-oncogene c-Myc, Transcription factor p64. pricing
ABE26 Anti-acetyl-c-Myc (Lys323) Antibody Use Anti-acetyl-c-Myc (Lys323) Antibody (Rabbit Polyclonal Antibody) validated in WB to detect acetyl-c-Myc (Lys323) also known as HLHe39, Proto-oncogene c-Myc, Transcription factor p64, c-MYC. pricing
AB15467 Anti-ARG3.1 Antibody Detect ARG3.1 using this Anti-ARG3.1 Antibody validated for use in IH. pricing
AB3252 Anti-c-myc Antibody Anti-c-myc Antibody is a Chicken Polyclonal Antibody for detection of c-myc also known as Proto-oncogene c-Myc & has been tested in IP, WB, ICC. pricing
CBL434 Anti-c-myc Antibody, clone 3C7 Detect c-myc also known as Proto-oncogene c-Myc with Anti-c-myc Antibody, clone 3C7 (Mouse Monoclonal Antibody), that has been demonstrated to work in ELISA, IP & WB. pricing
MABE282 Anti-c-Myc Antibody, clone 9E10 Anti-c-Myc Antibody, clone 9E10 is a Mouse Monoclonal Antibody for detection of c-Myc also known as Myc proto-oncogene protein, HLHe39, Transcription factor p64 & has been validated in WB, ChIP. pricing
MAB8864 Anti-c-myc Antibody, clone 9E10.3 Detect c-myc also known as Proto-oncogene c-Myc with Anti-c-myc Antibody, clone 9E10.3 (Mouse Monoclonal Antibody), that has been demonstrated to work in FC, WB, IHC, IHC(P). pricing
06-340 Anti-Myc Antibody Use Anti-Myc Antibody (rabbit polyclonal antibody) validated in ChIP, ICC, IP, WB to detect Myc also known as Transcription factor p64, avian myelocytomatosis viral oncogene homolog, myc proto-oncogene protein. pricing
06-549 Anti-Myc Tag Antibody Anti-Myc Tag Antibody is an antibody against Myc Tag for use in IC & WB. pricing
05-724 Anti-Myc Tag Antibody, clone 4A6 This Anti-Myc Tag Antibody, clone 4A6 is validated for use in ChIP, IC, IF, IP, WB for the detection of Myc Tag. This antibody has been cited in more than 25 published papers. pricing
05-724MG Anti-Myc Tag Antibody, clone 4A6 Detect Myc Tag using this Anti-Myc Tag Antibody, clone 4A6 validated for use in ChIP, IF, IP, WB & IC. pricing
16-219 Anti-Myc Tag Antibody, clone 4A6, agarose conjugate Anti-Myc Tag Antibody, clone 4A6, agarose conjugate detects level of Myc Tag & has been published & validated for use in IP. pricing
16-224 Anti-Myc Tag Antibody, clone 4A6, Alexa Fluor® 488 conjugate Anti-Myc Tag Antibody, clone 4A6, Alexa Fluor 488 conjugate is an antibody against Myc Tag for use in IF, WB & IC. pricing
16-225 Anti-Myc Tag Antibody, clone 4A6, Alexa Fluor® 555 conjugate This Anti-Myc Tag Antibody, clone 4A6, Alexa Fluor 555 conjugate is validated for use in IF, WB, IC for the detection of Myc Tag. pricing
16-212 Anti-Myc Tag Antibody, clone 4A6, biotin conjugate Detect Myc Tag using this Anti-Myc Tag Antibody, clone 4A6, biotin conjugate validated for use in WB. pricing
16-213 Anti-Myc Tag Antibody, clone 4A6, HRP conjugate Anti-Myc Tag Antibody, clone 4A6, HRP conjugate detects level of Myc Tag & has been published & validated for use in WB. pricing
05-419 Anti-Myc Tag Antibody, clone 9E10 Anti-Myc Tag Antibody, clone 9E10 is an antibody against Myc Tag for use in IH(P), IC, IP & WB. pricing
16-308 Anti-Myc Tag Antibody, clone 9E10, Alexa Fluor® 488 conjugate This Anti-Myc Tag Antibody, clone 9E10, Alexa Fluor 488 conjugate is validated for use in WB, IC for the detection of Myc Tag. pricing
16-263 Anti-Myc Tag Antibody, clone 9E10, Alexa Fluor® 555 conjugate Detect Myc Tag using this Anti-Myc Tag Antibody, clone 9E10, Alexa Fluor 555 conjugate validated for use in WB & IC. pricing
16-170 Anti-Myc Tag Antibody, clone 9E10, biotin conjugate Anti-Myc Tag Antibody, clone 9E10, biotin conjugate detects level of Myc Tag & has been published & validated for use in WB & IC. pricing
SF-736 MYC; Human, Cyanine 3, RNA Detection Probe | SmartFlare MYC can be assayed in live cells using SmartFlare probes. The fluorescent reporter release can be detected by microscopy, flow cytometry, and FACS if enrichment of live cells based on Myc levels is desired. pricing
SF-702 MYC; Human, Cyanine 5, RNA Detection Probe | SmartFlare MYC can be assayed in live cells using SmartFlare probes. The fluorescent reporter release can be detected by microscopy, flow cytometry, and FACS if enrichment of live cells based on Myc levels is desired. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002467 Rosetta Predictions human pricing
NM_012603 Rosetta Predictions rat pricing
NM_010849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222676 predicted 1778
2 SASI_Hs01_00222677 predicted 1086
3 SASI_Hs01_00222678 predicted 1349
4 SASI_Hs01_00222680 predicted 592
5 SASI_Hs02_00333889 predicted 1389
6 SASI_Hs01_00222681 predicted 1616
7 SASI_Hs01_00222682 predicted 1004
8 SASI_Hs01_00222683 predicted 1534
9 SASI_Hs01_00222684 predicted 1661
10 SASI_Hs01_00222685 predicted 1544
11 SASI_Hs01_00222679 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089127 predicted 1843
2 SASI_Rn01_00089128 predicted 1793
3 SASI_Rn01_00089129 predicted 606
4 SASI_Rn01_00089130 predicted 859
5 SASI_Rn01_00089131 predicted 1772
6 SASI_Rn01_00089132 predicted 1206
7 SASI_Rn01_00089133 predicted 575
8 SASI_Rn01_00089134 predicted 1631
9 SASI_Rn01_00089135 predicted 1480
10 SASI_Rn01_00089136 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157474 predicted 980
2 SASI_Mm01_00157475 predicted 1894
3 SASI_Mm01_00157476 predicted 1060
4 SASI_Mm01_00157477 predicted 1823
5 SASI_Mm01_00157478 predicted 1409
6 SASI_Mm01_00157479 predicted 1853
7 SASI_Mm01_00157480 predicted 913
8 SASI_Mm01_00157481 predicted 1756
9 SASI_Mm01_00157482 predicted 646
10 SASI_Mm01_00157483 predicted 1683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010849
VALIDATED
MYC MISSION shRNA Bacterial Glycerol Stock
v-myc avian myelocytomatosis viral oncogene homolog
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-681s1c1
Sequence:CCGGCGACGAGGAAGAGAATTTCTACTCGAGTAGAAATTCTCTTCCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1905s1c1
Sequence:CCGGGCTTCGAAACTCTGGTGCATACTCGAGTATGCACCAGAGTTTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-904s1c1
Sequence:CCGGCTGGAGATGATGACCGAGTTACTCGAGTAACTCGGTCATCATCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-691s1c1
Sequence:CCGGGAGAATTTCTATCACCAGCAACTCGAGTTGCTGGTGATAGAAATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-821s1c1
Sequence:CCGGCATCCTATGTTGCGGTCGCTACTCGAGTAGCGACCGCAACATAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1602s1c1
Sequence:CCGGCCTGAAGCAGATCAGCAACAACTCGAGTTGTTGCTGATCTGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1807s1c1
Sequence:CCGGGCCTACATCCTGTCCATTCAACTCGAGTTGAATGGACAGGATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.4-1758s21c1
Sequence:CCGGCGTGACCAGATCCCTGAATTGCTCGAGCAATTCAGGGATCTGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1675s1c1
Sequence:CCGGCGGACACACAACGTCTTGGAACTCGAGTTCCAAGACGTTGTGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.2-1876s1c1
Sequence:CCGGCGAGAACAGTTGAAACACAAACTCGAGTTTGTGTTTCAACTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1392s1c1
Sequence:CCGGTGATGTGGTGTCTGTGGAGAACTCGAGTTCTCCACAGACACCACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010849.4-2082s21c1
Sequence:CCGGTGTAAGCTTCAGCCATAATTTCTCGAGAAATTATGGCTGAAGCTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010849.4-925s21c1
Sequence:CCGGTGGAGATGATGACCGAGTTACCTCGAGGTAACTCGGTCATCATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.4-675s21c1
Sequence:CCGGGACTCCGTACAGCCCTATTTCCTCGAGGAAATAGGGCTGTACGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010849
VALIDATED
MYC MISSION shRNA shRNA Plasmid DNA
v-myc avian myelocytomatosis viral oncogene homolog
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-681s1c1
Sequence:CCGGCGACGAGGAAGAGAATTTCTACTCGAGTAGAAATTCTCTTCCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1905s1c1
Sequence:CCGGGCTTCGAAACTCTGGTGCATACTCGAGTATGCACCAGAGTTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-904s1c1
Sequence:CCGGCTGGAGATGATGACCGAGTTACTCGAGTAACTCGGTCATCATCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-691s1c1
Sequence:CCGGGAGAATTTCTATCACCAGCAACTCGAGTTGCTGGTGATAGAAATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-821s1c1
Sequence:CCGGCATCCTATGTTGCGGTCGCTACTCGAGTAGCGACCGCAACATAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1602s1c1
Sequence:CCGGCCTGAAGCAGATCAGCAACAACTCGAGTTGTTGCTGATCTGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1807s1c1
Sequence:CCGGGCCTACATCCTGTCCATTCAACTCGAGTTGAATGGACAGGATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.4-1758s21c1
Sequence:CCGGCGTGACCAGATCCCTGAATTGCTCGAGCAATTCAGGGATCTGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1675s1c1
Sequence:CCGGCGGACACACAACGTCTTGGAACTCGAGTTCCAAGACGTTGTGTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.2-1876s1c1
Sequence:CCGGCGAGAACAGTTGAAACACAAACTCGAGTTTGTGTTTCAACTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1392s1c1
Sequence:CCGGTGATGTGGTGTCTGTGGAGAACTCGAGTTCTCCACAGACACCACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010849.4-2082s21c1
Sequence:CCGGTGTAAGCTTCAGCCATAATTTCTCGAGAAATTATGGCTGAAGCTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010849.4-925s21c1
Sequence:CCGGTGGAGATGATGACCGAGTTACCTCGAGGTAACTCGGTCATCATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.4-675s21c1
Sequence:CCGGGACTCCGTACAGCCCTATTTCCTCGAGGAAATAGGGCTGTACGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010849
VALIDATED
MYC MISSION shRNA Lentiviral Transduction Particles
v-myc avian myelocytomatosis viral oncogene homolog
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-681s1c1
Sequence:CCGGCGACGAGGAAGAGAATTTCTACTCGAGTAGAAATTCTCTTCCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1905s1c1
Sequence:CCGGGCTTCGAAACTCTGGTGCATACTCGAGTATGCACCAGAGTTTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-904s1c1
Sequence:CCGGCTGGAGATGATGACCGAGTTACTCGAGTAACTCGGTCATCATCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-691s1c1
Sequence:CCGGGAGAATTTCTATCACCAGCAACTCGAGTTGCTGGTGATAGAAATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-821s1c1
Sequence:CCGGCATCCTATGTTGCGGTCGCTACTCGAGTAGCGACCGCAACATAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1602s1c1
Sequence:CCGGCCTGAAGCAGATCAGCAACAACTCGAGTTGTTGCTGATCTGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1807s1c1
Sequence:CCGGGCCTACATCCTGTCCATTCAACTCGAGTTGAATGGACAGGATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.4-1758s21c1
Sequence:CCGGCGTGACCAGATCCCTGAATTGCTCGAGCAATTCAGGGATCTGGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1675s1c1
Sequence:CCGGCGGACACACAACGTCTTGGAACTCGAGTTCCAAGACGTTGTGTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.2-1876s1c1
Sequence:CCGGCGAGAACAGTTGAAACACAAACTCGAGTTTGTGTTTCAACTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010849.2-1392s1c1
Sequence:CCGGTGATGTGGTGTCTGTGGAGAACTCGAGTTCTCCACAGACACCACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010849.4-2082s21c1
Sequence:CCGGTGTAAGCTTCAGCCATAATTTCTCGAGAAATTATGGCTGAAGCTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010849.4-925s21c1
Sequence:CCGGTGGAGATGATGACCGAGTTACCTCGAGGTAACTCGGTCATCATCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010849.4-675s21c1
Sequence:CCGGGACTCCGTACAGCCCTATTTCCTCGAGGAAATAGGGCTGTACGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002467
VALIDATED
MYC MISSION shRNA Bacterial Glycerol Stock
v-myc avian myelocytomatosis viral oncogene homolog
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002467.2-1377s1c2
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1870s21c1
Sequence:CCGGTACGGAACTCTTGTGCGTAAGCTCGAGCTTACGCACAAGAGTTCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1661s21c1
Sequence:CCGGCCAGAGGAGGAACGAGCTAAACTCGAGTTTAGCTCGTTCCTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002467.2-1377s1c1
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002467.2-408s1c1
Sequence:CCGGCAGGAACTATGACCTCGACTACTCGAGTAGTCGAGGTCATAGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002467.2-1657s1c1
Sequence:CCGGCAGTTGAAACACAAACTTGAACTCGAGTTCAAGTTTGTGTTTCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002467.2-1828s1c1
Sequence:CCGGCCATAATGTAAACTGCCTCAACTCGAGTTGAGGCAGTTTACATTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002467.3-2002s21c1
Sequence:CCGGACTGAAAGATTTAGCCATAATCTCGAGATTATGGCTAAATCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.4-620s21c1
Sequence:CCGGACTCGGTGCAGCCGTATTTCTCTCGAGAGAAATACGGCTGCACCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1565s21c1
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-586s21c1
Sequence:CCGGGCTTCACCAACAGGAACTATGCTCGAGCATAGTTCCTGTTGGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.4-952s21c1
Sequence:CCGGATCATCATCCAGGACTGTATGCTCGAGCATACAGTCCTGGATGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002467
VALIDATED
MYC MISSION shRNA shRNA Plasmid DNA
v-myc avian myelocytomatosis viral oncogene homolog
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002467.2-1377s1c2
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1870s21c1
Sequence:CCGGTACGGAACTCTTGTGCGTAAGCTCGAGCTTACGCACAAGAGTTCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1661s21c1
Sequence:CCGGCCAGAGGAGGAACGAGCTAAACTCGAGTTTAGCTCGTTCCTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002467.2-1377s1c1
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002467.2-408s1c1
Sequence:CCGGCAGGAACTATGACCTCGACTACTCGAGTAGTCGAGGTCATAGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002467.2-1657s1c1
Sequence:CCGGCAGTTGAAACACAAACTTGAACTCGAGTTCAAGTTTGTGTTTCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002467.2-1828s1c1
Sequence:CCGGCCATAATGTAAACTGCCTCAACTCGAGTTGAGGCAGTTTACATTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002467.3-2002s21c1
Sequence:CCGGACTGAAAGATTTAGCCATAATCTCGAGATTATGGCTAAATCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.4-620s21c1
Sequence:CCGGACTCGGTGCAGCCGTATTTCTCTCGAGAGAAATACGGCTGCACCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1565s21c1
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-586s21c1
Sequence:CCGGGCTTCACCAACAGGAACTATGCTCGAGCATAGTTCCTGTTGGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.4-952s21c1
Sequence:CCGGATCATCATCCAGGACTGTATGCTCGAGCATACAGTCCTGGATGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002467
VALIDATED
MYC MISSION shRNA Lentiviral Transduction Particles
v-myc avian myelocytomatosis viral oncogene homolog
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002467.2-1377s1c2
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1870s21c1
Sequence:CCGGTACGGAACTCTTGTGCGTAAGCTCGAGCTTACGCACAAGAGTTCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1661s21c1
Sequence:CCGGCCAGAGGAGGAACGAGCTAAACTCGAGTTTAGCTCGTTCCTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002467.2-1377s1c1
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002467.2-408s1c1
Sequence:CCGGCAGGAACTATGACCTCGACTACTCGAGTAGTCGAGGTCATAGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002467.2-1657s1c1
Sequence:CCGGCAGTTGAAACACAAACTTGAACTCGAGTTCAAGTTTGTGTTTCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002467.2-1828s1c1
Sequence:CCGGCCATAATGTAAACTGCCTCAACTCGAGTTGAGGCAGTTTACATTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002467.3-2002s21c1
Sequence:CCGGACTGAAAGATTTAGCCATAATCTCGAGATTATGGCTAAATCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.4-620s21c1
Sequence:CCGGACTCGGTGCAGCCGTATTTCTCTCGAGAGAAATACGGCTGCACCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-1565s21c1
Sequence:CCGGCCTGAGACAGATCAGCAACAACTCGAGTTGTTGCTGATCTGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.3-586s21c1
Sequence:CCGGGCTTCACCAACAGGAACTATGCTCGAGCATAGTTCCTGTTGGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002467.4-952s21c1
Sequence:CCGGATCATCATCCAGGACTGTATGCTCGAGCATACAGTCCTGGATGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)