EMAIL THIS PAGE TO A FRIEND

MYCBP2

MYC binding protein 2, E3 ubiquitin protein ligase

161 Gene Product Result for
Synonyms: PAM
Gene ID:
Mouse(105689) MYC binding protein 2
Rat(290447) MYC binding protein 2, E3 ubiquitin protein ligase
domestic guinea pig(100726232) MYC binding protein 2, E3 ubiquitin protein ligase
naked mole-rat(101712951) MYC binding protein 2, E3 ubiquitin protein ligase
sheep(101102993) MYC binding protein 2, E3 ubiquitin protein ligase
Zebrafish(368439) MYC binding protein 2
cow(534496) MYC binding protein 2
domestic cat(101089233) MYC binding protein 2, E3 ubiquitin protein ligase
dog(476952) MYC binding protein 2, E3 ubiquitin protein ligase
chicken(418808) MYC binding protein 2, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015057 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015057 Rosetta Predictions human pricing
NM_001106055 Rosetta Predictions rat pricing
NM_207215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229718 predicted 4511
2 SASI_Hs02_00346907 predicted 4802
3 SASI_Hs01_00229719 predicted 5234
4 SASI_Hs02_00346908 predicted 10283
5 SASI_Hs01_00229721 predicted 3387
6 SASI_Hs01_00229722 predicted 1823
7 SASI_Hs02_00346909 predicted 3400
8 SASI_Hs01_00229723 predicted 10471
9 SASI_Hs02_00346910 predicted 3729
10 SASI_Hs01_00229724 predicted 13320
11 SASI_Hs01_00229720 predicted 1665
12 SASI_Hs01_00229725 predicted 12053
13 SASI_Hs01_00229726 predicted 1466
14 SASI_Hs01_00229727 predicted 12602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215182 predicted 4739
2 SASI_Rn02_00215183 predicted 4382
3 SASI_Rn02_00215184 predicted 3652
4 SASI_Rn02_00215185 predicted 1455
5 SASI_Rn02_00215186 predicted 6090
6 SASI_Rn02_00215187 predicted 3286
7 SASI_Rn02_00215188 predicted 6229
8 SASI_Rn02_00215189 predicted 6242
9 SASI_Rn02_00215190 predicted 6904
10 SASI_Rn02_00215191 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158339 predicted 4757
2 SASI_Mm01_00158340 predicted 11437
3 SASI_Mm02_00351936 predicted 9395
4 SASI_Mm01_00158343 predicted 10733
5 SASI_Mm01_00158344 predicted 7843
6 SASI_Mm01_00158345 predicted 13965
7 SASI_Mm01_00158346 predicted 14499
8 SASI_Mm01_00158347 predicted 4023
9 SASI_Mm01_00158348 predicted 5109
10 SASI_Mm02_00351937 predicted 1543
11 SASI_Mm01_00158341 predicted 11508
12 SASI_Mm01_00158342 predicted 10030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207215
VALIDATED
MYCBP2 MISSION shRNA Bacterial Glycerol Stock
MYC binding protein 2, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.1-7020s1c1
Sequence:CCGGGCGGTATATTGCCATAACAATCTCGAGATTGTTATGGCAATATACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.1-13739s1c1
Sequence:CCGGCCATGAATAGATACGCATATTCTCGAGAATATGCGTATCTATTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207215.1-14318s1c1
Sequence:CCGGCCGTGTACATAATTCTTGCTACTCGAGTAGCAAGAATTATGTACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-14092s21c1
Sequence:CCGGCATGAATAGATACGCATATTACTCGAGTAATATGCGTATCTATTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.2-5653s1c1
Sequence:CCGGGACGTCTCTAGAATTAGTTAACTCGAGTTAACTAATTCTAGAGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207215.2-4320s21c1
Sequence:CCGGCTCACGGCCAAGCGTCTATTACTCGAGTAATAGACGCTTGGCCGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-5653s21c1
Sequence:CCGGGACGTCTCTAGAATTAGTTAACTCGAGTTAACTAATTCTAGAGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-505s21c1
Sequence:CCGGAGATCGCTACCGGAGGATTTACTCGAGTAAATCCTCCGGTAGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207215.2-14992s21c1
Sequence:CCGGGTGTTAGTAAGGCCTATAAATCTCGAGATTTATAGGCCTTACTAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207215
VALIDATED
MYCBP2 MISSION shRNA shRNA Plasmid DNA
MYC binding protein 2, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.1-7020s1c1
Sequence:CCGGGCGGTATATTGCCATAACAATCTCGAGATTGTTATGGCAATATACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.1-13739s1c1
Sequence:CCGGCCATGAATAGATACGCATATTCTCGAGAATATGCGTATCTATTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207215.1-14318s1c1
Sequence:CCGGCCGTGTACATAATTCTTGCTACTCGAGTAGCAAGAATTATGTACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-14092s21c1
Sequence:CCGGCATGAATAGATACGCATATTACTCGAGTAATATGCGTATCTATTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.2-5653s1c1
Sequence:CCGGGACGTCTCTAGAATTAGTTAACTCGAGTTAACTAATTCTAGAGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207215.2-4320s21c1
Sequence:CCGGCTCACGGCCAAGCGTCTATTACTCGAGTAATAGACGCTTGGCCGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-5653s21c1
Sequence:CCGGGACGTCTCTAGAATTAGTTAACTCGAGTTAACTAATTCTAGAGACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-505s21c1
Sequence:CCGGAGATCGCTACCGGAGGATTTACTCGAGTAAATCCTCCGGTAGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207215.2-14992s21c1
Sequence:CCGGGTGTTAGTAAGGCCTATAAATCTCGAGATTTATAGGCCTTACTAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207215
VALIDATED
MYCBP2 MISSION shRNA Lentiviral Transduction Particles
MYC binding protein 2, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.1-7020s1c1
Sequence:CCGGGCGGTATATTGCCATAACAATCTCGAGATTGTTATGGCAATATACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.1-13739s1c1
Sequence:CCGGCCATGAATAGATACGCATATTCTCGAGAATATGCGTATCTATTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207215.1-14318s1c1
Sequence:CCGGCCGTGTACATAATTCTTGCTACTCGAGTAGCAAGAATTATGTACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-14092s21c1
Sequence:CCGGCATGAATAGATACGCATATTACTCGAGTAATATGCGTATCTATTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207215.2-5653s1c1
Sequence:CCGGGACGTCTCTAGAATTAGTTAACTCGAGTTAACTAATTCTAGAGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207215.2-4320s21c1
Sequence:CCGGCTCACGGCCAAGCGTCTATTACTCGAGTAATAGACGCTTGGCCGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-5653s21c1
Sequence:CCGGGACGTCTCTAGAATTAGTTAACTCGAGTTAACTAATTCTAGAGACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_207215.2-505s21c1
Sequence:CCGGAGATCGCTACCGGAGGATTTACTCGAGTAAATCCTCCGGTAGCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207215.2-14992s21c1
Sequence:CCGGGTGTTAGTAAGGCCTATAAATCTCGAGATTTATAGGCCTTACTAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015057
VALIDATED
MYCBP2 MISSION shRNA Bacterial Glycerol Stock
MYC binding protein 2, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-4442s1c1
Sequence:CCGGGCGTGTCTATACCTGTGAAATCTCGAGATTTCACAGGTATAGACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-9217s1c1
Sequence:CCGGCCAAAGAACATGCTCCTATAACTCGAGTTATAGGAGCATGTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-10258s1c1
Sequence:CCGGGCTATCAAGATGACAATCTATCTCGAGATAGATTGTCATCTTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-5096s1c1
Sequence:CCGGCGTCTCTAACACCTGTGGATTCTCGAGAATCCACAGGTGTTAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-11946s1c1
Sequence:CCGGGCTCATATTGTCCAAGCTATTCTCGAGAATAGCTTGGACAATATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-5143s21c1
Sequence:CCGGAGCTAGTGCTAACCGATTTACCTCGAGGTAAATCGGTTAGCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-6047s21c1
Sequence:CCGGGAGAGTGAGCACCCGTATAAACTCGAGTTTATACGGGTGCTCACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-7069s21c1
Sequence:CCGGAGTGAAGGAAGCTCGATATATCTCGAGATATATCGAGCTTCCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015057.3-1111s21c1
Sequence:CCGGATTATGCAAGGATGGATTATACTCGAGTATAATCCATCCTTGCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015057.3-14495s21c1
Sequence:CCGGGTGTTAGGACAGCATATAAATCTCGAGATTTATATGCTGTCCTAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015057
VALIDATED
MYCBP2 MISSION shRNA shRNA Plasmid DNA
MYC binding protein 2, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-4442s1c1
Sequence:CCGGGCGTGTCTATACCTGTGAAATCTCGAGATTTCACAGGTATAGACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-9217s1c1
Sequence:CCGGCCAAAGAACATGCTCCTATAACTCGAGTTATAGGAGCATGTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-10258s1c1
Sequence:CCGGGCTATCAAGATGACAATCTATCTCGAGATAGATTGTCATCTTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-5096s1c1
Sequence:CCGGCGTCTCTAACACCTGTGGATTCTCGAGAATCCACAGGTGTTAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-11946s1c1
Sequence:CCGGGCTCATATTGTCCAAGCTATTCTCGAGAATAGCTTGGACAATATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-5143s21c1
Sequence:CCGGAGCTAGTGCTAACCGATTTACCTCGAGGTAAATCGGTTAGCACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-6047s21c1
Sequence:CCGGGAGAGTGAGCACCCGTATAAACTCGAGTTTATACGGGTGCTCACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-7069s21c1
Sequence:CCGGAGTGAAGGAAGCTCGATATATCTCGAGATATATCGAGCTTCCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015057.3-1111s21c1
Sequence:CCGGATTATGCAAGGATGGATTATACTCGAGTATAATCCATCCTTGCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015057.3-14495s21c1
Sequence:CCGGGTGTTAGGACAGCATATAAATCTCGAGATTTATATGCTGTCCTAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015057
VALIDATED
MYCBP2 MISSION shRNA Lentiviral Transduction Particles
MYC binding protein 2, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-4442s1c1
Sequence:CCGGGCGTGTCTATACCTGTGAAATCTCGAGATTTCACAGGTATAGACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-9217s1c1
Sequence:CCGGCCAAAGAACATGCTCCTATAACTCGAGTTATAGGAGCATGTTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-10258s1c1
Sequence:CCGGGCTATCAAGATGACAATCTATCTCGAGATAGATTGTCATCTTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-5096s1c1
Sequence:CCGGCGTCTCTAACACCTGTGGATTCTCGAGAATCCACAGGTGTTAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015057.1-11946s1c1
Sequence:CCGGGCTCATATTGTCCAAGCTATTCTCGAGAATAGCTTGGACAATATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-5143s21c1
Sequence:CCGGAGCTAGTGCTAACCGATTTACCTCGAGGTAAATCGGTTAGCACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-6047s21c1
Sequence:CCGGGAGAGTGAGCACCCGTATAAACTCGAGTTTATACGGGTGCTCACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015057.3-7069s21c1
Sequence:CCGGAGTGAAGGAAGCTCGATATATCTCGAGATATATCGAGCTTCCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015057.3-1111s21c1
Sequence:CCGGATTATGCAAGGATGGATTATACTCGAGTATAATCCATCCTTGCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015057.3-14495s21c1
Sequence:CCGGGTGTTAGGACAGCATATAAATCTCGAGATTTATATGCTGTCCTAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)