EMAIL THIS PAGE TO A FRIEND

MYCBPAP

MYCBP associated protein

50 Gene Product Result for
Synonyms: AMAP-1 AMAP1
UniProtKB ID: Q8TBZ2, A6NHJ3, Q8TDV8, Q9H0K0
Gene ID:
Mouse(104601) MYCBP associated protein
Rat(494192) Mycbp associated protein
Zebrafish(100006494) mycbp associated protein
dog(480552) MYCBP associated protein
cow(505551) MYCBP associated protein
Horse(100069971) MYCBP associated protein
domestic cat(101099257) MYCBP associated protein
chicken(422101) MYCBP associated protein
sheep(101117522) MYCBP associated protein
naked mole-rat(101708838) MYCBP associated protein
domestic guinea pig(100714381) MYCBP associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032133 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008601 MISSION® esiRNA esiRNA targeting human MYCBPAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032133 Rosetta Predictions human pricing
NM_001009482 Rosetta Predictions rat pricing
NM_170671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135764 predicted 1031
2 SASI_Hs01_00135765 predicted 1238
3 SASI_Hs01_00135766 predicted 1539
4 SASI_Hs01_00135767 predicted 381
5 SASI_Hs01_00135768 predicted 1993
6 SASI_Hs01_00135769 predicted 831
7 SASI_Hs01_00135770 predicted 1576
8 SASI_Hs01_00135771 predicted 967
9 SASI_Hs01_00135773 predicted 2146
10 SASI_Hs02_00359356 predicted 2788
11 SASI_Hs01_00135772 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037930 predicted 1102
2 SASI_Rn01_00037932 predicted 426
3 SASI_Rn01_00037933 predicted 1318
4 SASI_Rn01_00037934 predicted 985
5 SASI_Rn01_00037935 predicted 1496
6 SASI_Rn01_00037936 predicted 1285
7 SASI_Rn01_00037937 predicted 1102
8 SASI_Rn01_00037938 predicted 2493
9 SASI_Rn02_00199556 predicted 2278
10 SASI_Rn02_00199557 predicted 579
11 SASI_Rn01_00037931 predicted 2605
12 SASI_Rn01_00037939 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200950 predicted 2515
2 SASI_Mm01_00200951 predicted 1034
3 SASI_Mm02_00343561 predicted 1041
4 SASI_Mm01_00200952 predicted 1293
5 SASI_Mm01_00200953 predicted 1343
6 SASI_Mm02_00343562 predicted 1891
7 SASI_Mm01_00200954 predicted 1160
8 SASI_Mm01_00200955 predicted 2335
9 SASI_Mm01_00200957 predicted 1803
10 SASI_Mm02_00343563 predicted 635
11 SASI_Mm01_00200956 predicted 1754
12 SASI_Mm01_00200958 predicted 1939
13 SASI_Mm01_00200959 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170671
MYCBPAP MISSION shRNA Bacterial Glycerol Stock
MYCBP associated protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.2-193s1c1
Sequence:CCGGATTCTTGCCTTGGCCATTAAACTCGAGTTTAATGGCCAAGGCAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1435s1c1
Sequence:CCGGCGGAAGAGCATTATGGAGGAACTCGAGTTCCTCCATAATGCTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-1158s1c1
Sequence:CCGGCAGGAATCCTAGGTTGCATTACTCGAGTAATGCAACCTAGGATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-857s1c1
Sequence:CCGGCCAAACACTTTACCTTCTTCTCTCGAGAGAAGAAGGTAAAGTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-1891s1c1
Sequence:CCGGCTGGGTACCAAAGACAAAGATCTCGAGATCTTTGTCTTTGGTACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-522s1c1
Sequence:CCGGCACGGTATTTCTAGACTCCTTCTCGAGAAGGAGTCTAGAAATACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1525s1c1
Sequence:CCGGCCTAAGTGGAACCTGTGTCTACTCGAGTAGACACAGGTTCCACTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1756s1c1
Sequence:CCGGCCTGAGAAGGAGACGGTTTATCTCGAGATAAACCGTCTCCTTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-354s1c1
Sequence:CCGGGTTTCTGATCTACCGACGCAACTCGAGTTGCGTCGGTAGATCAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170671
MYCBPAP MISSION shRNA shRNA Plasmid DNA
MYCBP associated protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.2-193s1c1
Sequence:CCGGATTCTTGCCTTGGCCATTAAACTCGAGTTTAATGGCCAAGGCAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1435s1c1
Sequence:CCGGCGGAAGAGCATTATGGAGGAACTCGAGTTCCTCCATAATGCTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-1158s1c1
Sequence:CCGGCAGGAATCCTAGGTTGCATTACTCGAGTAATGCAACCTAGGATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-857s1c1
Sequence:CCGGCCAAACACTTTACCTTCTTCTCTCGAGAGAAGAAGGTAAAGTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-1891s1c1
Sequence:CCGGCTGGGTACCAAAGACAAAGATCTCGAGATCTTTGTCTTTGGTACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-522s1c1
Sequence:CCGGCACGGTATTTCTAGACTCCTTCTCGAGAAGGAGTCTAGAAATACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1525s1c1
Sequence:CCGGCCTAAGTGGAACCTGTGTCTACTCGAGTAGACACAGGTTCCACTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1756s1c1
Sequence:CCGGCCTGAGAAGGAGACGGTTTATCTCGAGATAAACCGTCTCCTTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-354s1c1
Sequence:CCGGGTTTCTGATCTACCGACGCAACTCGAGTTGCGTCGGTAGATCAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170671
MYCBPAP MISSION shRNA Lentiviral Transduction Particles
MYCBP associated protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.2-193s1c1
Sequence:CCGGATTCTTGCCTTGGCCATTAAACTCGAGTTTAATGGCCAAGGCAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1435s1c1
Sequence:CCGGCGGAAGAGCATTATGGAGGAACTCGAGTTCCTCCATAATGCTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-1158s1c1
Sequence:CCGGCAGGAATCCTAGGTTGCATTACTCGAGTAATGCAACCTAGGATTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-857s1c1
Sequence:CCGGCCAAACACTTTACCTTCTTCTCTCGAGAGAAGAAGGTAAAGTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-1891s1c1
Sequence:CCGGCTGGGTACCAAAGACAAAGATCTCGAGATCTTTGTCTTTGGTACCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170671.1-522s1c1
Sequence:CCGGCACGGTATTTCTAGACTCCTTCTCGAGAAGGAGTCTAGAAATACCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1525s1c1
Sequence:CCGGCCTAAGTGGAACCTGTGTCTACTCGAGTAGACACAGGTTCCACTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-1756s1c1
Sequence:CCGGCCTGAGAAGGAGACGGTTTATCTCGAGATAAACCGTCTCCTTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170671.1-354s1c1
Sequence:CCGGGTTTCTGATCTACCGACGCAACTCGAGTTGCGTCGGTAGATCAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032133
MYCBPAP MISSION shRNA Bacterial Glycerol Stock
MYCBP associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-1357s1c1
Sequence:CCGGGCTGCTCACTTGACCTTTGAACTCGAGTTCAAAGGTCAAGTGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-220s1c1
Sequence:CCGGCCTGTTAGCAATGTCCTACAACTCGAGTTGTAGGACATTGCTAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-2454s1c1
Sequence:CCGGGAAGGAGACCATCTATTTGAACTCGAGTTCAAATAGATGGTCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1618s1c1
Sequence:CCGGCGAACCCATCCTACTCTATTACTCGAGTAATAGAGTAGGATGGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-217s1c1
Sequence:CCGGGAACCTGTTAGCAATGTCCTACTCGAGTAGGACATTGCTAACAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-1469s1c1
Sequence:CCGGCGGACACTTTCCAAGACCTTACTCGAGTAAGGTCTTGGAAAGTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1322s1c1
Sequence:CCGGGCAGTAATCCACAGGACAAGACTCGAGTCTTGTCCTGTGGATTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-880s1c1
Sequence:CCGGCGACTGGAATACTTGGGAGATCTCGAGATCTCCCAAGTATTCCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1375s1c1
Sequence:CCGGGAAACCCTAGAAGGCGAGAAACTCGAGTTTCTCGCCTTCTAGGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-2658s1c1
Sequence:CCGGGCACAAGGCAAAGGATGACAACTCGAGTTGTCATCCTTTGCCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032133
MYCBPAP MISSION shRNA shRNA Plasmid DNA
MYCBP associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-1357s1c1
Sequence:CCGGGCTGCTCACTTGACCTTTGAACTCGAGTTCAAAGGTCAAGTGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-220s1c1
Sequence:CCGGCCTGTTAGCAATGTCCTACAACTCGAGTTGTAGGACATTGCTAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-2454s1c1
Sequence:CCGGGAAGGAGACCATCTATTTGAACTCGAGTTCAAATAGATGGTCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1618s1c1
Sequence:CCGGCGAACCCATCCTACTCTATTACTCGAGTAATAGAGTAGGATGGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-217s1c1
Sequence:CCGGGAACCTGTTAGCAATGTCCTACTCGAGTAGGACATTGCTAACAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-1469s1c1
Sequence:CCGGCGGACACTTTCCAAGACCTTACTCGAGTAAGGTCTTGGAAAGTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1322s1c1
Sequence:CCGGGCAGTAATCCACAGGACAAGACTCGAGTCTTGTCCTGTGGATTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-880s1c1
Sequence:CCGGCGACTGGAATACTTGGGAGATCTCGAGATCTCCCAAGTATTCCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1375s1c1
Sequence:CCGGGAAACCCTAGAAGGCGAGAAACTCGAGTTTCTCGCCTTCTAGGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-2658s1c1
Sequence:CCGGGCACAAGGCAAAGGATGACAACTCGAGTTGTCATCCTTTGCCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032133
MYCBPAP MISSION shRNA Lentiviral Transduction Particles
MYCBP associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-1357s1c1
Sequence:CCGGGCTGCTCACTTGACCTTTGAACTCGAGTTCAAAGGTCAAGTGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-220s1c1
Sequence:CCGGCCTGTTAGCAATGTCCTACAACTCGAGTTGTAGGACATTGCTAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-2454s1c1
Sequence:CCGGGAAGGAGACCATCTATTTGAACTCGAGTTCAAATAGATGGTCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1618s1c1
Sequence:CCGGCGAACCCATCCTACTCTATTACTCGAGTAATAGAGTAGGATGGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-217s1c1
Sequence:CCGGGAACCTGTTAGCAATGTCCTACTCGAGTAGGACATTGCTAACAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-1469s1c1
Sequence:CCGGCGGACACTTTCCAAGACCTTACTCGAGTAAGGTCTTGGAAAGTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1322s1c1
Sequence:CCGGGCAGTAATCCACAGGACAAGACTCGAGTCTTGTCCTGTGGATTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-880s1c1
Sequence:CCGGCGACTGGAATACTTGGGAGATCTCGAGATCTCCCAAGTATTCCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032133.2-1375s1c1
Sequence:CCGGGAAACCCTAGAAGGCGAGAAACTCGAGTTTCTCGCCTTCTAGGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032133.2-2658s1c1
Sequence:CCGGGCACAAGGCAAAGGATGACAACTCGAGTTGTCATCCTTTGCCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)