EMAIL THIS PAGE TO A FRIEND

MYCL

v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog

221 Gene Product Result for
Synonyms: LMYC MYCL1 bHLHe38
Gene ID:
Mouse(16918) v-myc myelocytomatosis viral oncogene homolog, lung carcinoma derived (avian)
Rat(298506) v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
cow(540350) v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033081 Rosetta Predictions human pricing
NM_001033082 Rosetta Predictions human pricing
NM_005376 Rosetta Predictions human pricing
XM_001054061 Rosetta Predictions rat pricing
XM_001054123 Rosetta Predictions rat pricing
XM_233490 Rosetta Predictions rat pricing
NM_008506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084779 predicted 819
2 SASI_Hs01_00084780 predicted 827
3 SASI_Hs01_00084781 predicted 851
4 SASI_Hs01_00084782 predicted 770
5 SASI_Hs01_00084783 predicted 824
6 SASI_Hs01_00084784 predicted 828
7 SASI_Hs01_00084785 predicted 778
8 SASI_Hs01_00084786 predicted 774
9 SASI_Hs01_00084787 predicted 780
10 SASI_Hs01_00084788 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115365 predicted 457
2 SASI_Hs01_00115366 predicted 468
3 SASI_Hs01_00115367 predicted 480
4 SASI_Hs01_00115368 predicted 463
5 SASI_Hs01_00115369 predicted 462
6 SASI_Hs01_00115370 predicted 415
7 SASI_Hs01_00115371 predicted 407
8 SASI_Hs01_00115372 predicted 417
9 SASI_Hs01_00115373 predicted 470
10 SASI_Hs01_00115374 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111508 predicted 459
2 SASI_Hs01_00111509 predicted 468
3 SASI_Hs01_00111510 predicted 486
4 SASI_Hs01_00111511 predicted 464
5 SASI_Hs01_00111512 predicted 465
6 SASI_Hs01_00111513 predicted 417
7 SASI_Hs01_00111514 predicted 407
8 SASI_Hs01_00111515 predicted 417
9 SASI_Hs01_00111516 predicted 471
10 SASI_Hs01_00111517 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274552 predicted 1378
2 SASI_Rn02_00274553 predicted 1575
3 SASI_Rn02_00274554 predicted 414
4 SASI_Rn02_00274555 predicted 1612
5 SASI_Rn02_00274556 predicted 1257
6 SASI_Rn02_00274557 predicted 1342
7 SASI_Rn02_00274558 predicted 1138
8 SASI_Rn02_00274559 predicted 1297
9 SASI_Rn02_00274560 predicted 415
10 SASI_Rn02_00274561 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274828 predicted 1602
2 SASI_Rn02_00274829 predicted 1790
3 SASI_Rn02_00274830 predicted 624
4 SASI_Rn02_00274831 predicted 1832
5 SASI_Rn02_00274832 predicted 1476
6 SASI_Rn02_00274833 predicted 1550
7 SASI_Rn02_00274834 predicted 1353
8 SASI_Rn02_00274835 predicted 1520
9 SASI_Rn02_00274836 predicted 629
10 SASI_Rn02_00274837 predicted 1796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387824 predicted 652
2 SASI_Rn02_00387825 predicted 1619
3 SASI_Rn02_00387826 predicted 1268
4 SASI_Rn02_00387827 predicted 1569
5 SASI_Rn02_00387828 predicted 1377
6 SASI_Rn02_00387829 predicted 1535
7 SASI_Rn02_00387830 predicted 994
8 SASI_Rn02_00387831 predicted 107
9 SASI_Rn02_00387832 predicted 1003
10 SASI_Rn02_00387833 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105112 predicted 431
2 SASI_Mm01_00105111 predicted 455
3 SASI_Mm01_00105114 predicted 953
4 SASI_Mm01_00105115 predicted 1838
5 SASI_Mm01_00105116 predicted 1559
6 SASI_Mm01_00105117 predicted 1512
7 SASI_Mm01_00105118 predicted 1290
8 SASI_Mm01_00105119 predicted 1013
9 SASI_Mm01_00105120 predicted 817
10 SASI_Mm02_00314059 predicted 1406
11 SASI_Mm01_00105113 predicted 1887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008506
MYCL MISSION shRNA Bacterial Glycerol Stock
v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1402s1c1
Sequence:CCGGCCTCAGCAAGGCGTTAGAATACTCGAGTATTCTAACGCCTTGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1057s1c1
Sequence:CCGGGCATAACTATGCTGCCCGTTTCTCGAGAAACGGGCAGCATAGTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-673s1c1
Sequence:CCGGCAGGAATTATGCTTCCATCATCTCGAGATGATGGAAGCATAATTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1017s1c1
Sequence:CCGGCCTGCATGAAGCACTTCCATACTCGAGTATGGAAGTGCTTCATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008506.2-460s21c1
Sequence:CCGGCTATGACTGCGGAGAGGATTTCTCGAGAAATCCTCTCCGCAGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008506.2-1557s21c1
Sequence:CCGGTCTCACAGACACAAGCTTATTCTCGAGAATAAGCTTGTGTCTGTGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008506.2-1701s21c1
Sequence:CCGGTGGTAACCTCGAAACCCAATTCTCGAGAATTGGGTTTCGAGGTTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008506.2-581s21c1
Sequence:CCGGGACCCAGCCTCTGGGATTAATCTCGAGATTAATCCCAGAGGCTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008506
MYCL MISSION shRNA shRNA Plasmid DNA
v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1402s1c1
Sequence:CCGGCCTCAGCAAGGCGTTAGAATACTCGAGTATTCTAACGCCTTGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1057s1c1
Sequence:CCGGGCATAACTATGCTGCCCGTTTCTCGAGAAACGGGCAGCATAGTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-673s1c1
Sequence:CCGGCAGGAATTATGCTTCCATCATCTCGAGATGATGGAAGCATAATTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1017s1c1
Sequence:CCGGCCTGCATGAAGCACTTCCATACTCGAGTATGGAAGTGCTTCATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008506.2-460s21c1
Sequence:CCGGCTATGACTGCGGAGAGGATTTCTCGAGAAATCCTCTCCGCAGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008506.2-1557s21c1
Sequence:CCGGTCTCACAGACACAAGCTTATTCTCGAGAATAAGCTTGTGTCTGTGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008506.2-1701s21c1
Sequence:CCGGTGGTAACCTCGAAACCCAATTCTCGAGAATTGGGTTTCGAGGTTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008506.2-581s21c1
Sequence:CCGGGACCCAGCCTCTGGGATTAATCTCGAGATTAATCCCAGAGGCTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008506
MYCL MISSION shRNA Lentiviral Transduction Particles
v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1402s1c1
Sequence:CCGGCCTCAGCAAGGCGTTAGAATACTCGAGTATTCTAACGCCTTGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1057s1c1
Sequence:CCGGGCATAACTATGCTGCCCGTTTCTCGAGAAACGGGCAGCATAGTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-673s1c1
Sequence:CCGGCAGGAATTATGCTTCCATCATCTCGAGATGATGGAAGCATAATTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008506.2-1017s1c1
Sequence:CCGGCCTGCATGAAGCACTTCCATACTCGAGTATGGAAGTGCTTCATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008506.2-460s21c1
Sequence:CCGGCTATGACTGCGGAGAGGATTTCTCGAGAAATCCTCTCCGCAGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008506.2-1557s21c1
Sequence:CCGGTCTCACAGACACAAGCTTATTCTCGAGAATAAGCTTGTGTCTGTGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008506.2-1701s21c1
Sequence:CCGGTGGTAACCTCGAAACCCAATTCTCGAGAATTGGGTTTCGAGGTTACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008506.2-581s21c1
Sequence:CCGGGACCCAGCCTCTGGGATTAATCTCGAGATTAATCCCAGAGGCTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005376
VALIDATED
MYCL MISSION shRNA Bacterial Glycerol Stock
v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-1552s1c1
Sequence:CCGGCCTGTGCCACTAAACTACATTCTCGAGAATGTAGTTTAGTGGCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-183s1c1
Sequence:CCGGCGAGGACATCTGGAAGAAATTCTCGAGAATTTCTTCCAGATGTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-354s1c1
Sequence:CCGGCAGGAACTACGCCTCCATCATCTCGAGATGATGGAGGCGTAGTTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-588s1c1
Sequence:CCGGCCCAAGCGACTCGGGTAAGGACTCGAGTCCTTACCCGAGTCGCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-678s1c1
Sequence:CCGGCATTGGCTCTTCTCAAGCTCTCTCGAGAGAGCTTGAGAAGAGCCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-1165s21c1
Sequence:CCGGTCTCCAGTTGGCTTTACTTTACTCGAGTAAAGTAAAGCCAACTGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-884s21c1
Sequence:CCGGTGTTGGTAAACAGTTTGGAAACTCGAGTTTCCAAACTGTTTACCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-976s21c1
Sequence:CCGGTGGCGCTTAGAGAGGACAATACTCGAGTATTGTCCTCTCTAAGCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-873s21c1
Sequence:CCGGGCACGTGGGTGTGTTGGTAAACTCGAGTTTACCAACACACCCACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-1300s21c1
Sequence:CCGGGAGGCTTAGAGATAGACAATCCTCGAGGATTGTCTATCTCTAAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005376
VALIDATED
MYCL MISSION shRNA shRNA Plasmid DNA
v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-1552s1c1
Sequence:CCGGCCTGTGCCACTAAACTACATTCTCGAGAATGTAGTTTAGTGGCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-183s1c1
Sequence:CCGGCGAGGACATCTGGAAGAAATTCTCGAGAATTTCTTCCAGATGTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-354s1c1
Sequence:CCGGCAGGAACTACGCCTCCATCATCTCGAGATGATGGAGGCGTAGTTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-588s1c1
Sequence:CCGGCCCAAGCGACTCGGGTAAGGACTCGAGTCCTTACCCGAGTCGCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-678s1c1
Sequence:CCGGCATTGGCTCTTCTCAAGCTCTCTCGAGAGAGCTTGAGAAGAGCCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-1165s21c1
Sequence:CCGGTCTCCAGTTGGCTTTACTTTACTCGAGTAAAGTAAAGCCAACTGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-884s21c1
Sequence:CCGGTGTTGGTAAACAGTTTGGAAACTCGAGTTTCCAAACTGTTTACCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-976s21c1
Sequence:CCGGTGGCGCTTAGAGAGGACAATACTCGAGTATTGTCCTCTCTAAGCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-873s21c1
Sequence:CCGGGCACGTGGGTGTGTTGGTAAACTCGAGTTTACCAACACACCCACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-1300s21c1
Sequence:CCGGGAGGCTTAGAGATAGACAATCCTCGAGGATTGTCTATCTCTAAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005376
VALIDATED
MYCL MISSION shRNA Lentiviral Transduction Particles
v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-1552s1c1
Sequence:CCGGCCTGTGCCACTAAACTACATTCTCGAGAATGTAGTTTAGTGGCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-183s1c1
Sequence:CCGGCGAGGACATCTGGAAGAAATTCTCGAGAATTTCTTCCAGATGTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-354s1c1
Sequence:CCGGCAGGAACTACGCCTCCATCATCTCGAGATGATGGAGGCGTAGTTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-588s1c1
Sequence:CCGGCCCAAGCGACTCGGGTAAGGACTCGAGTCCTTACCCGAGTCGCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005376.2-678s1c1
Sequence:CCGGCATTGGCTCTTCTCAAGCTCTCTCGAGAGAGCTTGAGAAGAGCCAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-1165s21c1
Sequence:CCGGTCTCCAGTTGGCTTTACTTTACTCGAGTAAAGTAAAGCCAACTGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-884s21c1
Sequence:CCGGTGTTGGTAAACAGTTTGGAAACTCGAGTTTCCAAACTGTTTACCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-976s21c1
Sequence:CCGGTGGCGCTTAGAGAGGACAATACTCGAGTATTGTCCTCTCTAAGCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-873s21c1
Sequence:CCGGGCACGTGGGTGTGTTGGTAAACTCGAGTTTACCAACACACCCACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005376.3-1300s21c1
Sequence:CCGGGAGGCTTAGAGATAGACAATCCTCGAGGATTGTCTATCTCTAAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)