EMAIL THIS PAGE TO A FRIEND

MYCLP1

MYCL pseudogene 1

1 Gene Product Result for
Synonyms: MYCL1P1 MYCL2 bHLHe38
Species: Human MYCLP1(4611)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302690 ANTI-MYCL2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005377 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005377
MYCLP1 MISSION shRNA Bacterial Glycerol Stock
MYCL pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-1088s1c1
Sequence:CCGGGCCACGGAATACTTACATGAACTCGAGTTCATGTAAGTATTCCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-1053s1c1
Sequence:CCGGGCTCTAGGGTTTCCAAAGTAACTCGAGTTACTTTGGAAACCCTAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-921s1c1
Sequence:CCGGCCAAACCCATCCATTATGATACTCGAGTATCATAATGGATGGGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005377.2-1215s1c1
Sequence:CCGGGCCTGACCATTCTGTCTTAAACTCGAGTTTAAGACAGAATGGTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-628s1c1
Sequence:CCGGCGTGACAGTAAAGAAGAGGCACTCGAGTGCCTCTTCTTTACTGTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005377
MYCLP1 MISSION shRNA shRNA Plasmid DNA
MYCL pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-1088s1c1
Sequence:CCGGGCCACGGAATACTTACATGAACTCGAGTTCATGTAAGTATTCCGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-1053s1c1
Sequence:CCGGGCTCTAGGGTTTCCAAAGTAACTCGAGTTACTTTGGAAACCCTAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-921s1c1
Sequence:CCGGCCAAACCCATCCATTATGATACTCGAGTATCATAATGGATGGGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005377.2-1215s1c1
Sequence:CCGGGCCTGACCATTCTGTCTTAAACTCGAGTTTAAGACAGAATGGTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-628s1c1
Sequence:CCGGCGTGACAGTAAAGAAGAGGCACTCGAGTGCCTCTTCTTTACTGTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005377
MYCLP1 MISSION shRNA Lentiviral Transduction Particles
MYCL pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-1088s1c1
Sequence:CCGGGCCACGGAATACTTACATGAACTCGAGTTCATGTAAGTATTCCGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-1053s1c1
Sequence:CCGGGCTCTAGGGTTTCCAAAGTAACTCGAGTTACTTTGGAAACCCTAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-921s1c1
Sequence:CCGGCCAAACCCATCCATTATGATACTCGAGTATCATAATGGATGGGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005377.2-1215s1c1
Sequence:CCGGGCCTGACCATTCTGTCTTAAACTCGAGTTTAAGACAGAATGGTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005377.2-628s1c1
Sequence:CCGGCGTGACAGTAAAGAAGAGGCACTCGAGTGCCTCTTCTTTACTGTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)