EMAIL THIS PAGE TO A FRIEND

MYCN

v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog

125 Gene Product Result for
Synonyms: MODED MYCNOT N-myc NMYC ODED bHLHe37
UniProtKB ID: P04198, Q6LDT9
Gene ID:
Human(4613) Summary: This gene is a member of the MYC family and encodes a protein with a basic helix-loop-helix (bHLH) domain. This protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of this gene is associated with a variety of tumors, most notably neuroblastomas. [provided by RefSeq, Jul 2008]
Mouse(18109) v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
Rat(298894) v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
Zebrafish(252851) v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
cow(281334) v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
cow(616888) v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
chicken(421948) v-myc myelocytomatosis viral related oncogene, neuroblastoma derived
dog(482978) v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
domestic cat(101093013) v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
sheep(101105814) v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
domestic guinea pig(100727557) v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005378 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005378 Rosetta Predictions human pricing
NM_001013096 Rosetta Predictions rat pricing
NM_008709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026891 predicted 2156
2 SASI_Hs02_00339484 predicted 2174
3 SASI_Hs01_00026892 predicted 1425
4 SASI_Hs01_00026893 predicted 1974
5 SASI_Hs01_00026894 predicted 2165
6 SASI_Hs02_00339485 predicted 1971
7 SASI_Hs01_00026897 predicted 1963
8 SASI_Hs02_00339486 predicted 374
9 SASI_Hs01_00026898 predicted 2135
10 SASI_Hs01_00026899 predicted 378
11 SASI_Hs01_00026895 predicted 1303
12 SASI_Hs01_00026896 predicted 2172
13 SASI_Hs01_00026900 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076963 predicted 2166
2 SASI_Rn01_00076964 predicted 2170
3 SASI_Rn01_00076965 predicted 1156
4 SASI_Rn01_00076966 predicted 367
5 SASI_Rn01_00076967 predicted 1367
6 SASI_Rn01_00076968 predicted 2143
7 SASI_Rn01_00076969 predicted 1064
8 SASI_Rn01_00076970 predicted 1045
9 SASI_Rn01_00076971 predicted 608
10 SASI_Rn01_00076972 predicted 2159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314535 predicted 2156
2 SASI_Mm02_00314536 predicted 2162
3 SASI_Mm01_00125344 predicted 1162
4 SASI_Mm01_00125345 predicted 1133
5 SASI_Mm02_00314537 predicted 2131
6 SASI_Mm01_00125346 predicted 1159
7 SASI_Mm01_00125347 predicted 1134
8 SASI_Mm01_00125348 predicted 607
9 SASI_Mm02_00314538 predicted 2150
10 SASI_Mm02_00314539 predicted 2069
11 SASI_Mm01_00125349 predicted 401
12 SASI_Mm01_00125350 predicted 1177
13 SASI_Mm01_00125351 predicted 943
14 SASI_Mm01_00125352 predicted 831
15 SASI_Mm01_00125353 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005378
VALIDATED
MYCN MISSION shRNA Bacterial Glycerol Stock
v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005378.3-2000s1c1
Sequence:CCGGGCCAGTATTAGACTGGAAGTTCTCGAGAACTTCCAGTCTAATACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-1284s1c1
Sequence:CCGGGCGTCGCAGAAACCACAACATCTCGAGATGTTGTGGTTTCTGCGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-919s1c1
Sequence:CCGGCTGAGCGATTCAGATGATGAACTCGAGTTCATCATCTGAATCGCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005378.3-230s1c1
Sequence:CCGGCGGACGAAGATGACTTCTACTCTCGAGAGTAGAAGTCATCTTCGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-1492s1c1
Sequence:CCGGCAGCAGCAGTTGCTAAAGAAACTCGAGTTTCTTTAGCAACTGCTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1683s21c1
Sequence:CCGGTCGGACTTGCTAGACGCTTCTCTCGAGAGAAGCGTCTAGCAAGTCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005378.4-1915s21c1
Sequence:CCGGCACCTCCATGACAGCGCTAAACTCGAGTTTAGCGCTGTCATGGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1648s21c1
Sequence:CCGGAGACAGCAGCAGTTGCTAAAGCTCGAGCTTTAGCAACTGCTGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1194s21c1
Sequence:CCGGCATCACTGTGCGTCCCAAGAACTCGAGTTCTTGGGACGCACAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1520s21c1
Sequence:CCGGACGTGCCGGAGTTGGTAAAGACTCGAGTCTTTACCAACTCCGGCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1368s21c1
Sequence:CCGGACGTCCGCTCAAGAGTGTCATCTCGAGATGACACTCTTGAGCGGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-534s21c1
Sequence:CCGGCACGGAGATGCTGCTTGAGAACTCGAGTTCTCAAGCAGCATCTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-381s21c1
Sequence:CCGGCTTCTACCCGGACGAAGATGACTCGAGTCATCTTCGTCCGGGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005378.4-2180s21c1
Sequence:CCGGCATACCTAAGTACTGTAATAACTCGAGTTATTACAGTACTTAGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005378
VALIDATED
MYCN MISSION shRNA shRNA Plasmid DNA
v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005378.3-2000s1c1
Sequence:CCGGGCCAGTATTAGACTGGAAGTTCTCGAGAACTTCCAGTCTAATACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-1284s1c1
Sequence:CCGGGCGTCGCAGAAACCACAACATCTCGAGATGTTGTGGTTTCTGCGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-919s1c1
Sequence:CCGGCTGAGCGATTCAGATGATGAACTCGAGTTCATCATCTGAATCGCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005378.3-230s1c1
Sequence:CCGGCGGACGAAGATGACTTCTACTCTCGAGAGTAGAAGTCATCTTCGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-1492s1c1
Sequence:CCGGCAGCAGCAGTTGCTAAAGAAACTCGAGTTTCTTTAGCAACTGCTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1683s21c1
Sequence:CCGGTCGGACTTGCTAGACGCTTCTCTCGAGAGAAGCGTCTAGCAAGTCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005378.4-1915s21c1
Sequence:CCGGCACCTCCATGACAGCGCTAAACTCGAGTTTAGCGCTGTCATGGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1648s21c1
Sequence:CCGGAGACAGCAGCAGTTGCTAAAGCTCGAGCTTTAGCAACTGCTGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1194s21c1
Sequence:CCGGCATCACTGTGCGTCCCAAGAACTCGAGTTCTTGGGACGCACAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1520s21c1
Sequence:CCGGACGTGCCGGAGTTGGTAAAGACTCGAGTCTTTACCAACTCCGGCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1368s21c1
Sequence:CCGGACGTCCGCTCAAGAGTGTCATCTCGAGATGACACTCTTGAGCGGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-534s21c1
Sequence:CCGGCACGGAGATGCTGCTTGAGAACTCGAGTTCTCAAGCAGCATCTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-381s21c1
Sequence:CCGGCTTCTACCCGGACGAAGATGACTCGAGTCATCTTCGTCCGGGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005378.4-2180s21c1
Sequence:CCGGCATACCTAAGTACTGTAATAACTCGAGTTATTACAGTACTTAGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005378
VALIDATED
MYCN MISSION shRNA Lentiviral Transduction Particles
v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005378.3-2000s1c1
Sequence:CCGGGCCAGTATTAGACTGGAAGTTCTCGAGAACTTCCAGTCTAATACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-1284s1c1
Sequence:CCGGGCGTCGCAGAAACCACAACATCTCGAGATGTTGTGGTTTCTGCGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-919s1c1
Sequence:CCGGCTGAGCGATTCAGATGATGAACTCGAGTTCATCATCTGAATCGCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005378.3-230s1c1
Sequence:CCGGCGGACGAAGATGACTTCTACTCTCGAGAGTAGAAGTCATCTTCGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005378.3-1492s1c1
Sequence:CCGGCAGCAGCAGTTGCTAAAGAAACTCGAGTTTCTTTAGCAACTGCTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1683s21c1
Sequence:CCGGTCGGACTTGCTAGACGCTTCTCTCGAGAGAAGCGTCTAGCAAGTCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005378.4-1915s21c1
Sequence:CCGGCACCTCCATGACAGCGCTAAACTCGAGTTTAGCGCTGTCATGGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1648s21c1
Sequence:CCGGAGACAGCAGCAGTTGCTAAAGCTCGAGCTTTAGCAACTGCTGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1194s21c1
Sequence:CCGGCATCACTGTGCGTCCCAAGAACTCGAGTTCTTGGGACGCACAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1520s21c1
Sequence:CCGGACGTGCCGGAGTTGGTAAAGACTCGAGTCTTTACCAACTCCGGCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-1368s21c1
Sequence:CCGGACGTCCGCTCAAGAGTGTCATCTCGAGATGACACTCTTGAGCGGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-534s21c1
Sequence:CCGGCACGGAGATGCTGCTTGAGAACTCGAGTTCTCAAGCAGCATCTCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005378.4-381s21c1
Sequence:CCGGCTTCTACCCGGACGAAGATGACTCGAGTCATCTTCGTCCGGGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005378.4-2180s21c1
Sequence:CCGGCATACCTAAGTACTGTAATAACTCGAGTTATTACAGTACTTAGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008709
VALIDATED
MYCN MISSION shRNA Bacterial Glycerol Stock
v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-1021s1c1
Sequence:CCGGGAAGAGACGTTCCTCCTCTAACTCGAGTTAGAGGAGGAACGTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-493s1c1
Sequence:CCGGCCTCACTCCTAATCCGGTCATCTCGAGATGACCGGATTAGGAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008709.2-1529s1c1
Sequence:CCGGCAGTTGCTAAAGAAGATCGAACTCGAGTTCGATCTTCTTTAGCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-944s1c1
Sequence:CCGGGATACCTTGAGCGACTCAGATCTCGAGATCTGAGTCGCTCAAGGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-1522s1c1
Sequence:CCGGGCAGCAGCAGTTGCTAAAGAACTCGAGTTCTTTAGCAACTGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1137s21c1
Sequence:CCGGGAAGAGACGTTCCTCCTCTAACTCGAGTTAGAGGAGGAACGTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1060s21c1
Sequence:CCGGGATACCTTGAGCGACTCAGATCTCGAGATCTGAGTCGCTCAAGGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-609s21c1
Sequence:CCGGCCTCACTCCTAATCCGGTCATCTCGAGATGACCGGATTAGGAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1645s21c1
Sequence:CCGGCAGTTGCTAAAGAAGATCGAACTCGAGTTCGATCTTCTTTAGCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008709
VALIDATED
MYCN MISSION shRNA shRNA Plasmid DNA
v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-1021s1c1
Sequence:CCGGGAAGAGACGTTCCTCCTCTAACTCGAGTTAGAGGAGGAACGTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-493s1c1
Sequence:CCGGCCTCACTCCTAATCCGGTCATCTCGAGATGACCGGATTAGGAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008709.2-1529s1c1
Sequence:CCGGCAGTTGCTAAAGAAGATCGAACTCGAGTTCGATCTTCTTTAGCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-944s1c1
Sequence:CCGGGATACCTTGAGCGACTCAGATCTCGAGATCTGAGTCGCTCAAGGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-1522s1c1
Sequence:CCGGGCAGCAGCAGTTGCTAAAGAACTCGAGTTCTTTAGCAACTGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1137s21c1
Sequence:CCGGGAAGAGACGTTCCTCCTCTAACTCGAGTTAGAGGAGGAACGTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1060s21c1
Sequence:CCGGGATACCTTGAGCGACTCAGATCTCGAGATCTGAGTCGCTCAAGGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-609s21c1
Sequence:CCGGCCTCACTCCTAATCCGGTCATCTCGAGATGACCGGATTAGGAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1645s21c1
Sequence:CCGGCAGTTGCTAAAGAAGATCGAACTCGAGTTCGATCTTCTTTAGCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008709
VALIDATED
MYCN MISSION shRNA Lentiviral Transduction Particles
v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-1021s1c1
Sequence:CCGGGAAGAGACGTTCCTCCTCTAACTCGAGTTAGAGGAGGAACGTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-493s1c1
Sequence:CCGGCCTCACTCCTAATCCGGTCATCTCGAGATGACCGGATTAGGAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008709.2-1529s1c1
Sequence:CCGGCAGTTGCTAAAGAAGATCGAACTCGAGTTCGATCTTCTTTAGCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-944s1c1
Sequence:CCGGGATACCTTGAGCGACTCAGATCTCGAGATCTGAGTCGCTCAAGGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008709.2-1522s1c1
Sequence:CCGGGCAGCAGCAGTTGCTAAAGAACTCGAGTTCTTTAGCAACTGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1137s21c1
Sequence:CCGGGAAGAGACGTTCCTCCTCTAACTCGAGTTAGAGGAGGAACGTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1060s21c1
Sequence:CCGGGATACCTTGAGCGACTCAGATCTCGAGATCTGAGTCGCTCAAGGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-609s21c1
Sequence:CCGGCCTCACTCCTAATCCGGTCATCTCGAGATGACCGGATTAGGAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008709.3-1645s21c1
Sequence:CCGGCAGTTGCTAAAGAAGATCGAACTCGAGTTCGATCTTCTTTAGCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)