EMAIL THIS PAGE TO A FRIEND

MYCT1

myc target 1

82 Gene Product Result for
Synonyms: MTLC
UniProtKB ID: Q8N699, Q8N396, Q8TBE8, Q9H763
Gene ID:
Mouse(68632) myc target 1
Rat(292264) myc target 1
sheep(101103483) myc target 1
Zebrafish(796556) myc target 1
cow(782134) myc target 1
dog(612005) myc target 1
chicken(421641) myc target 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025107 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033761 MISSION® esiRNA esiRNA targeting mouse Myct1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025107 Rosetta Predictions human pricing
NM_001106207 Rosetta Predictions rat pricing
NM_026793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098182 predicted 357
2 SASI_Hs01_00098183 predicted 554
3 SASI_Hs01_00098184 predicted 615
4 SASI_Hs01_00098185 predicted 669
5 SASI_Hs01_00098186 predicted 613
6 SASI_Hs01_00098188 predicted 458
7 SASI_Hs01_00098189 predicted 635
8 SASI_Hs01_00098190 predicted 563
9 SASI_Hs02_00357808 predicted 426
10 SASI_Hs01_00098191 predicted 618
11 SASI_Hs01_00098187 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216688 predicted 1033
2 SASI_Rn02_00216689 predicted 1112
3 SASI_Rn02_00216690 predicted 1064
4 SASI_Rn02_00216691 predicted 1010
5 SASI_Rn02_00216692 predicted 931
6 SASI_Rn02_00216693 predicted 1006
7 SASI_Rn02_00216694 predicted 938
8 SASI_Rn02_00216695 predicted 355
9 SASI_Rn02_00216696 predicted 194
10 SASI_Rn02_00216697 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158329 predicted 1031
2 SASI_Mm01_00158330 predicted 1128
3 SASI_Mm02_00330907 predicted 209
4 SASI_Mm02_00330908 predicted 466
5 SASI_Mm01_00158331 predicted 1105
6 SASI_Mm02_00330909 predicted 1124
7 SASI_Mm01_00158332 predicted 1103
8 SASI_Mm02_00330910 predicted 1094
9 SASI_Mm01_00158334 predicted 969
10 SASI_Mm02_00330911 predicted 415
11 SASI_Mm01_00158333 predicted 1142
12 SASI_Mm01_00158335 predicted 1105
13 SASI_Mm01_00158336 predicted 924
14 SASI_Mm01_00158337 predicted 424
15 SASI_Mm01_00158338 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026793
MYCT1 MISSION shRNA Bacterial Glycerol Stock
myc target 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026793.1-1268s1c1
Sequence:CCGGCCCAATAACAATTACCCATATCTCGAGATATGGGTAATTGTTATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026793.1-411s1c1
Sequence:CCGGCAAGCTTTAGGGCTTCGACTTCTCGAGAAGTCGAAGCCCTAAAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-680s21c1
Sequence:CCGGCGATTCCTGAGTCTGAGATTTCTCGAGAAATCTCAGACTCAGGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-213s21c1
Sequence:CCGGGGGCTTGCAATCGGAGGATTTCTCGAGAAATCCTCCGATTGCAAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026793.2-2456s21c1
Sequence:CCGGGTACGTCATTCTCGATGTTTACTCGAGTAAACATCGAGAATGACGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-268s21c1
Sequence:CCGGGAAGAGCCAGTGCACCCATTTCTCGAGAAATGGGTGCACTGGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-459s21c1
Sequence:CCGGAGCTTTAGGGCTTCGACTTTCCTCGAGGAAAGTCGAAGCCCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026793
MYCT1 MISSION shRNA shRNA Plasmid DNA
myc target 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026793.1-1268s1c1
Sequence:CCGGCCCAATAACAATTACCCATATCTCGAGATATGGGTAATTGTTATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026793.1-411s1c1
Sequence:CCGGCAAGCTTTAGGGCTTCGACTTCTCGAGAAGTCGAAGCCCTAAAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-680s21c1
Sequence:CCGGCGATTCCTGAGTCTGAGATTTCTCGAGAAATCTCAGACTCAGGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-213s21c1
Sequence:CCGGGGGCTTGCAATCGGAGGATTTCTCGAGAAATCCTCCGATTGCAAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026793.2-2456s21c1
Sequence:CCGGGTACGTCATTCTCGATGTTTACTCGAGTAAACATCGAGAATGACGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-268s21c1
Sequence:CCGGGAAGAGCCAGTGCACCCATTTCTCGAGAAATGGGTGCACTGGCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-459s21c1
Sequence:CCGGAGCTTTAGGGCTTCGACTTTCCTCGAGGAAAGTCGAAGCCCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026793
MYCT1 MISSION shRNA Lentiviral Transduction Particles
myc target 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026793.1-1268s1c1
Sequence:CCGGCCCAATAACAATTACCCATATCTCGAGATATGGGTAATTGTTATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026793.1-411s1c1
Sequence:CCGGCAAGCTTTAGGGCTTCGACTTCTCGAGAAGTCGAAGCCCTAAAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-680s21c1
Sequence:CCGGCGATTCCTGAGTCTGAGATTTCTCGAGAAATCTCAGACTCAGGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-213s21c1
Sequence:CCGGGGGCTTGCAATCGGAGGATTTCTCGAGAAATCCTCCGATTGCAAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026793.2-2456s21c1
Sequence:CCGGGTACGTCATTCTCGATGTTTACTCGAGTAAACATCGAGAATGACGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-268s21c1
Sequence:CCGGGAAGAGCCAGTGCACCCATTTCTCGAGAAATGGGTGCACTGGCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026793.2-459s21c1
Sequence:CCGGAGCTTTAGGGCTTCGACTTTCCTCGAGGAAAGTCGAAGCCCTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025107
MYCT1 MISSION shRNA Bacterial Glycerol Stock
myc target 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-323s1c1
Sequence:CCGGCAAGCAGGAGATCTAGGTCTTCTCGAGAAGACCTAGATCTCCTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025107.1-201s1c1
Sequence:CCGGCCTTATCATGTCCTTCACTGTCTCGAGACAGTGAAGGACATGATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-262s1c1
Sequence:CCGGGCTGTGTTCATTTGTCTGTCTCTCGAGAGACAGACAAATGAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-447s1c1
Sequence:CCGGCCTGGAACAAGCAAATTCCTTCTCGAGAAGGAATTTGCTTGTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025107.1-837s1c1
Sequence:CCGGGTGCAAGTTGGACATTACAATCTCGAGATTGTAATGTCCAACTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-305s1c1
Sequence:CCGGCCATCTCACAGTGGAGTTCAACTCGAGTTGAACTCCACTGTGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025107.2-60s21c1
Sequence:CCGGGTACTACAAAGAGATAGAATCCTCGAGGATTCTATCTCTTTGTAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025107.2-955s21c1
Sequence:CCGGATTCAATGTGAGGCTTATTAACTCGAGTTAATAAGCCTCACATTGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025107.2-996s21c1
Sequence:CCGGGAATCAGCTAAGATGCATTATCTCGAGATAATGCATCTTAGCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025107
MYCT1 MISSION shRNA shRNA Plasmid DNA
myc target 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-323s1c1
Sequence:CCGGCAAGCAGGAGATCTAGGTCTTCTCGAGAAGACCTAGATCTCCTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025107.1-201s1c1
Sequence:CCGGCCTTATCATGTCCTTCACTGTCTCGAGACAGTGAAGGACATGATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-262s1c1
Sequence:CCGGGCTGTGTTCATTTGTCTGTCTCTCGAGAGACAGACAAATGAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-447s1c1
Sequence:CCGGCCTGGAACAAGCAAATTCCTTCTCGAGAAGGAATTTGCTTGTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025107.1-837s1c1
Sequence:CCGGGTGCAAGTTGGACATTACAATCTCGAGATTGTAATGTCCAACTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-305s1c1
Sequence:CCGGCCATCTCACAGTGGAGTTCAACTCGAGTTGAACTCCACTGTGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025107.2-60s21c1
Sequence:CCGGGTACTACAAAGAGATAGAATCCTCGAGGATTCTATCTCTTTGTAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025107.2-955s21c1
Sequence:CCGGATTCAATGTGAGGCTTATTAACTCGAGTTAATAAGCCTCACATTGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025107.2-996s21c1
Sequence:CCGGGAATCAGCTAAGATGCATTATCTCGAGATAATGCATCTTAGCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025107
MYCT1 MISSION shRNA Lentiviral Transduction Particles
myc target 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-323s1c1
Sequence:CCGGCAAGCAGGAGATCTAGGTCTTCTCGAGAAGACCTAGATCTCCTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025107.1-201s1c1
Sequence:CCGGCCTTATCATGTCCTTCACTGTCTCGAGACAGTGAAGGACATGATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-262s1c1
Sequence:CCGGGCTGTGTTCATTTGTCTGTCTCTCGAGAGACAGACAAATGAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-447s1c1
Sequence:CCGGCCTGGAACAAGCAAATTCCTTCTCGAGAAGGAATTTGCTTGTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025107.1-837s1c1
Sequence:CCGGGTGCAAGTTGGACATTACAATCTCGAGATTGTAATGTCCAACTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025107.1-305s1c1
Sequence:CCGGCCATCTCACAGTGGAGTTCAACTCGAGTTGAACTCCACTGTGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025107.2-60s21c1
Sequence:CCGGGTACTACAAAGAGATAGAATCCTCGAGGATTCTATCTCTTTGTAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025107.2-955s21c1
Sequence:CCGGATTCAATGTGAGGCTTATTAACTCGAGTTAATAAGCCTCACATTGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025107.2-996s21c1
Sequence:CCGGGAATCAGCTAAGATGCATTATCTCGAGATAATGCATCTTAGCTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)