EMAIL THIS PAGE TO A FRIEND

MYD88

myeloid differentiation primary response 88

66 Gene Product Result for
Synonyms: MYD88D
UniProtKB ID: Q99836, B4DKH8, B4DQ60, B4DQ72, P78397, Q53XS7
Gene ID:
Human(4615) Summary: This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(17874) myeloid differentiation primary response gene 88
Rat(301059) myeloid differentiation primary response 88
Zebrafish(403145) myeloid differentiation primary response gene (88)
fruit fly(35956) CG2078 gene product from transcript CG2078-RB
domestic cat(101087092) myeloid differentiation primary response gene (88)
cow(444881) myeloid differentiation primary response gene (88)
dog(477024) myeloid differentiation primary response gene (88)
chicken(420420) myeloid differentiation primary response gene (88)
naked mole-rat(101712637) myeloid differentiation primary response 88
domestic guinea pig(100733381) myeloid differentiation primary response 88
sheep(678682) myeloid differentiation primary response gene (88)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS2125 Anti-MYD88 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS2127 Anti-MYD88 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB2500664 Anti-MYD88 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, chimpanzee, human, mouse, canine
ELISA, immunohistochemistry, western blot pricing
SAB1406154 Anti-MYD88 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
SAB2104398 Anti-MYD88 antibody produced in rabbit affinity isolated antibody horse, goat, pig, rat, rabbit, bovine, human, mouse, guinea pig, sheep
western blot pricing
SAB2104397 Anti-MYD88, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, human
western blot pricing
M0185 Anti-MyD88, Internal Domain antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB3500472 Monoclonal Anti-MyD88 antibody produced in mouse clone 2E9C2, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4100262 Monoclonal Anti-MYD88 antibody produced in mouse clone MYD88-A231, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002468 Rosetta Predictions human pricing
NM_198130 Rosetta Predictions rat pricing
NM_010851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111539 predicted 509
2 SASI_Hs01_00111540 predicted 1427
3 SASI_Hs01_00111541 predicted 348
4 SASI_Hs01_00111542 predicted 1290
5 SASI_Hs01_00111543 predicted 502
6 SASI_Hs01_00111544 predicted 879
7 SASI_Hs01_00111545 predicted 1078
8 SASI_Hs01_00111546 predicted 1154
9 SASI_Hs01_00111547 predicted 565
10 SASI_Hs02_00333890 predicted 1168
11 SASI_Hs01_00111538 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040290 predicted 771
2 SASI_Rn01_00040291 predicted 362
3 SASI_Rn01_00040292 predicted 230
4 SASI_Rn01_00040294 predicted 786
5 SASI_Rn01_00040295 predicted 839
6 SASI_Rn01_00040296 predicted 630
7 SASI_Rn02_00269912 predicted 517
8 SASI_Rn01_00040297 predicted 411
9 SASI_Rn01_00040298 predicted 1095
10 SASI_Rn01_00040299 predicted 499
11 SASI_Rn01_00040293 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160982 predicted 364
2 SASI_Mm02_00319507 predicted 1460
3 SASI_Mm01_00160983 predicted 1185
4 SASI_Mm01_00160984 predicted 493
5 SASI_Mm01_00160985 predicted 866
6 SASI_Mm01_00160986 predicted 461
7 SASI_Mm02_00319508 predicted 879
8 SASI_Mm01_00160988 predicted 630
9 SASI_Mm01_00160989 predicted 1211
10 SASI_Mm01_00160990 predicted 789
11 SASI_Mm01_00160987 predicted 1342
12 SASI_Mm01_00160991 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002468
MYD88 MISSION shRNA Bacterial Glycerol Stock
myeloid differentiation primary response 88
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-825s21c1
Sequence:CCGGGCACCTGTGTCTGGTCTATTGCTCGAGCAATAGACCAGACACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-394s21c1
Sequence:CCGGGTACTTGGAGATCCGGCAACTCTCGAGAGTTGCCGGATCTCCAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-705s21c1
Sequence:CCGGTCGATGCCTTCATCTGCTATTCTCGAGAATAGCAGATGAAGGCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-135s1c1
Sequence:CCGGCCTGTCTCTGTTCTTGAACGTCTCGAGACGTTCAAGAACAGAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002468.2-1825s1c1
Sequence:CCGGCCACCAACTTTGTACCTTGATCTCGAGATCAAGGTACAAAGTTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-723s1c1
Sequence:CCGGGCAGAGCAAGGAATGTGACTTCTCGAGAAGTCACATTCCTTGCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-588s1c1
Sequence:CCGGACAGACAAACTATCGACTGAACTCGAGTTCAGTCGATAGTTTGTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002468
MYD88 MISSION shRNA shRNA Plasmid DNA
myeloid differentiation primary response 88
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-825s21c1
Sequence:CCGGGCACCTGTGTCTGGTCTATTGCTCGAGCAATAGACCAGACACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-394s21c1
Sequence:CCGGGTACTTGGAGATCCGGCAACTCTCGAGAGTTGCCGGATCTCCAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-705s21c1
Sequence:CCGGTCGATGCCTTCATCTGCTATTCTCGAGAATAGCAGATGAAGGCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-135s1c1
Sequence:CCGGCCTGTCTCTGTTCTTGAACGTCTCGAGACGTTCAAGAACAGAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002468.2-1825s1c1
Sequence:CCGGCCACCAACTTTGTACCTTGATCTCGAGATCAAGGTACAAAGTTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-723s1c1
Sequence:CCGGGCAGAGCAAGGAATGTGACTTCTCGAGAAGTCACATTCCTTGCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-588s1c1
Sequence:CCGGACAGACAAACTATCGACTGAACTCGAGTTCAGTCGATAGTTTGTCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002468
MYD88 MISSION shRNA Lentiviral Transduction Particles
myeloid differentiation primary response 88
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-825s21c1
Sequence:CCGGGCACCTGTGTCTGGTCTATTGCTCGAGCAATAGACCAGACACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-394s21c1
Sequence:CCGGGTACTTGGAGATCCGGCAACTCTCGAGAGTTGCCGGATCTCCAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002468.4-705s21c1
Sequence:CCGGTCGATGCCTTCATCTGCTATTCTCGAGAATAGCAGATGAAGGCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-135s1c1
Sequence:CCGGCCTGTCTCTGTTCTTGAACGTCTCGAGACGTTCAAGAACAGAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002468.2-1825s1c1
Sequence:CCGGCCACCAACTTTGTACCTTGATCTCGAGATCAAGGTACAAAGTTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-723s1c1
Sequence:CCGGGCAGAGCAAGGAATGTGACTTCTCGAGAAGTCACATTCCTTGCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002468.2-588s1c1
Sequence:CCGGACAGACAAACTATCGACTGAACTCGAGTTCAGTCGATAGTTTGTCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010851
VALIDATED
MYD88 MISSION shRNA Bacterial Glycerol Stock
myeloid differentiation primary response 88
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-1648s21c1
Sequence:CCGGCCTTTCACGTTCTCTACCATACTCGAGTATGGTAGAGAACGTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-703s21c1
Sequence:CCGGGCCAGCGAGCTAATTGAGAAACTCGAGTTTCTCAATTAGCTCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-831s21c1
Sequence:CCGGGCGACTGATTCCTATTAAATACTCGAGTATTTAATAGGAATCAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010851.2-362s21c1
Sequence:CCGGCCTTGTTAGACCGTGAGGATACTCGAGTATCCTCACGGTCTAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-1648s1c1
Sequence:CCGGCCTTTCACGTTCTCTACCATACTCGAGTATGGTAGAGAACGTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-362s1c1
Sequence:CCGGCCTTGTTAGACCGTGAGGATACTCGAGTATCCTCACGGTCTAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010851.2-126s1c1
Sequence:CCGGCTTCATGTTCTCCATACCCTTCTCGAGAAGGGTATGGAGAACATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010851.2-831s1c1
Sequence:CCGGGCGACTGATTCCTATTAAATACTCGAGTATTTAATAGGAATCAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-703s1c1
Sequence:CCGGGCCAGCGAGCTAATTGAGAAACTCGAGTTTCTCAATTAGCTCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010851
VALIDATED
MYD88 MISSION shRNA shRNA Plasmid DNA
myeloid differentiation primary response 88
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-1648s21c1
Sequence:CCGGCCTTTCACGTTCTCTACCATACTCGAGTATGGTAGAGAACGTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-703s21c1
Sequence:CCGGGCCAGCGAGCTAATTGAGAAACTCGAGTTTCTCAATTAGCTCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-831s21c1
Sequence:CCGGGCGACTGATTCCTATTAAATACTCGAGTATTTAATAGGAATCAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010851.2-362s21c1
Sequence:CCGGCCTTGTTAGACCGTGAGGATACTCGAGTATCCTCACGGTCTAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-1648s1c1
Sequence:CCGGCCTTTCACGTTCTCTACCATACTCGAGTATGGTAGAGAACGTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-362s1c1
Sequence:CCGGCCTTGTTAGACCGTGAGGATACTCGAGTATCCTCACGGTCTAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010851.2-126s1c1
Sequence:CCGGCTTCATGTTCTCCATACCCTTCTCGAGAAGGGTATGGAGAACATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010851.2-831s1c1
Sequence:CCGGGCGACTGATTCCTATTAAATACTCGAGTATTTAATAGGAATCAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-703s1c1
Sequence:CCGGGCCAGCGAGCTAATTGAGAAACTCGAGTTTCTCAATTAGCTCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010851
VALIDATED
MYD88 MISSION shRNA Lentiviral Transduction Particles
myeloid differentiation primary response 88
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-1648s21c1
Sequence:CCGGCCTTTCACGTTCTCTACCATACTCGAGTATGGTAGAGAACGTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-703s21c1
Sequence:CCGGGCCAGCGAGCTAATTGAGAAACTCGAGTTTCTCAATTAGCTCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010851.2-831s21c1
Sequence:CCGGGCGACTGATTCCTATTAAATACTCGAGTATTTAATAGGAATCAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010851.2-362s21c1
Sequence:CCGGCCTTGTTAGACCGTGAGGATACTCGAGTATCCTCACGGTCTAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-1648s1c1
Sequence:CCGGCCTTTCACGTTCTCTACCATACTCGAGTATGGTAGAGAACGTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-362s1c1
Sequence:CCGGCCTTGTTAGACCGTGAGGATACTCGAGTATCCTCACGGTCTAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010851.2-126s1c1
Sequence:CCGGCTTCATGTTCTCCATACCCTTCTCGAGAAGGGTATGGAGAACATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010851.2-831s1c1
Sequence:CCGGGCGACTGATTCCTATTAAATACTCGAGTATTTAATAGGAATCAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010851.2-703s1c1
Sequence:CCGGGCCAGCGAGCTAATTGAGAAACTCGAGTTTCTCAATTAGCTCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)