EMAIL THIS PAGE TO A FRIEND

MYEF2

myelin expression factor 2

145 Gene Product Result for
Synonyms: HsT18564 MEF-2 MST156 MSTP156
Gene ID:
Mouse(17876) myelin basic protein expression factor 2, repressor
Rat(679712) myelin expression factor 2
sheep(101109884) myelin expression factor 2
domestic guinea pig(100716084) myelin expression factor 2
naked mole-rat(101720331) myelin expression factor 2
Domestic Rabbit(100346905) myelin expression factor 2
Zebrafish(641483) myelin expression factor 2
cow(524920) myelin expression factor 2
domestic cat(101085129) myelin expression factor 2
dog(487544) myelin expression factor 2
chicken(415432) myelin expression factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32738 Anti-MyEF2 antibody produced in rabbit affinity isolated antibody bovine, canine, zebrafish, rat, horse, rabbit, guinea pig, mouse, human
immunohistochemistry, western blot pricing
HPA004883 Anti-MYEF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103960 Anti-MYEF2, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, bovine, mouse, horse, rat, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016132 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016132 Rosetta Predictions human pricing
NM_001013205 Rosetta Predictions rat pricing
NM_010852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015977 predicted 1351
2 SASI_Hs01_00015978 predicted 341
3 SASI_Hs01_00015979 predicted 1617
4 SASI_Hs01_00015980 predicted 607
5 SASI_Hs01_00015981 predicted 1853
6 SASI_Hs01_00015982 predicted 479
7 SASI_Hs01_00015983 predicted 712
8 SASI_Hs02_00348925 predicted 1504
9 SASI_Hs02_00348926 predicted 1572
10 SASI_Hs01_00015984 predicted 447
11 SASI_Hs01_00015985 predicted 691
12 SASI_Hs01_00015986 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200985 predicted 597
2 SASI_Rn02_00200986 predicted 1701
3 SASI_Rn02_00200987 predicted 1145
4 SASI_Rn02_00200988 predicted 1724
5 SASI_Rn02_00200989 predicted 423
6 SASI_Rn02_00200990 predicted 449
7 SASI_Rn02_00200991 predicted 298
8 SASI_Rn02_00200992 predicted 1018
9 SASI_Rn02_00200993 predicted 1587
10 SASI_Rn02_00200994 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108250 predicted 1113
2 SASI_Mm01_00108251 predicted 869
3 SASI_Mm01_00108252 predicted 590
4 SASI_Mm01_00108253 predicted 713
5 SASI_Mm01_00108254 predicted 295
6 SASI_Mm01_00108255 predicted 966
7 SASI_Mm01_00108256 predicted 1027
8 SASI_Mm01_00108257 predicted 503
9 SASI_Mm01_00108258 predicted 764
10 SASI_Mm01_00108259 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016132
VALIDATED
MYEF2 MISSION shRNA Bacterial Glycerol Stock
myelin expression factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-1317s1c1
Sequence:CCGGCGTGGTGATATTGGAATAAATCTCGAGATTTATTCCAATATCACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016132.2-717s1c1
Sequence:CCGGCCTCCTGAAGTCATCAGTAATCTCGAGATTACTGATGACTTCAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-532s1c1
Sequence:CCGGCCCTAGAAACTATGAACAAATCTCGAGATTTGTTCATAGTTTCTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016132.2-1798s1c1
Sequence:CCGGGCAGAATAATGAATGGCATAACTCGAGTTATGCCATTCATTATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-424s1c1
Sequence:CCGGGAGAGAAAGTTGGTGAGGTTACTCGAGTAACCTCACCAACTTTCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016132.3-2195s21c1
Sequence:CCGGCAGTACTACATAGTTGGATTTCTCGAGAAATCCAACTATGTAGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016132.3-2377s21c1
Sequence:CCGGAGATTCTAAGGTTCAAGATTTCTCGAGAAATCTTGAACCTTAGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016132.3-1901s21c1
Sequence:CCGGGATGTTCGCTTGGATCGTAATCTCGAGATTACGATCCAAGCGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016132.3-454s21c1
Sequence:CCGGCATGAAATGGCAAGCTATTAACTCGAGTTAATAGCTTGCCATTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016132
VALIDATED
MYEF2 MISSION shRNA shRNA Plasmid DNA
myelin expression factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-1317s1c1
Sequence:CCGGCGTGGTGATATTGGAATAAATCTCGAGATTTATTCCAATATCACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016132.2-717s1c1
Sequence:CCGGCCTCCTGAAGTCATCAGTAATCTCGAGATTACTGATGACTTCAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-532s1c1
Sequence:CCGGCCCTAGAAACTATGAACAAATCTCGAGATTTGTTCATAGTTTCTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016132.2-1798s1c1
Sequence:CCGGGCAGAATAATGAATGGCATAACTCGAGTTATGCCATTCATTATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-424s1c1
Sequence:CCGGGAGAGAAAGTTGGTGAGGTTACTCGAGTAACCTCACCAACTTTCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016132.3-2195s21c1
Sequence:CCGGCAGTACTACATAGTTGGATTTCTCGAGAAATCCAACTATGTAGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016132.3-2377s21c1
Sequence:CCGGAGATTCTAAGGTTCAAGATTTCTCGAGAAATCTTGAACCTTAGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016132.3-1901s21c1
Sequence:CCGGGATGTTCGCTTGGATCGTAATCTCGAGATTACGATCCAAGCGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016132.3-454s21c1
Sequence:CCGGCATGAAATGGCAAGCTATTAACTCGAGTTAATAGCTTGCCATTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016132
VALIDATED
MYEF2 MISSION shRNA Lentiviral Transduction Particles
myelin expression factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-1317s1c1
Sequence:CCGGCGTGGTGATATTGGAATAAATCTCGAGATTTATTCCAATATCACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016132.2-717s1c1
Sequence:CCGGCCTCCTGAAGTCATCAGTAATCTCGAGATTACTGATGACTTCAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-532s1c1
Sequence:CCGGCCCTAGAAACTATGAACAAATCTCGAGATTTGTTCATAGTTTCTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016132.2-1798s1c1
Sequence:CCGGGCAGAATAATGAATGGCATAACTCGAGTTATGCCATTCATTATTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016132.2-424s1c1
Sequence:CCGGGAGAGAAAGTTGGTGAGGTTACTCGAGTAACCTCACCAACTTTCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016132.3-2195s21c1
Sequence:CCGGCAGTACTACATAGTTGGATTTCTCGAGAAATCCAACTATGTAGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016132.3-2377s21c1
Sequence:CCGGAGATTCTAAGGTTCAAGATTTCTCGAGAAATCTTGAACCTTAGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016132.3-1901s21c1
Sequence:CCGGGATGTTCGCTTGGATCGTAATCTCGAGATTACGATCCAAGCGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016132.3-454s21c1
Sequence:CCGGCATGAAATGGCAAGCTATTAACTCGAGTTAATAGCTTGCCATTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010852
VALIDATED
MYEF2 MISSION shRNA Bacterial Glycerol Stock
myelin expression factor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-70s1c1
Sequence:CCGGGCCAATCGGTTCCATCCTTATCTCGAGATAAGGATGGAACCGATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-1355s1c1
Sequence:CCGGGCAACCAGATATTTGTTAGAACTCGAGTTCTAACAAATATCTGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-1432s1c1
Sequence:CCGGCATGTAATGTTTGCAGAGATACTCGAGTATCTCTGCAAACATTACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010852.1-888s1c1
Sequence:CCGGGCTGAACATAACTGGTGTAATCTCGAGATTACACCAGTTATGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-180s1c1
Sequence:CCGGGCAGGCTATTAAAGATTTGATCTCGAGATCAAATCTTTAATAGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-344s21c1
Sequence:CCGGGCCAATCGGTTCCATCCTTATCTCGAGATAAGGATGGAACCGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-1162s21c1
Sequence:CCGGGCTGAACATAACTGGTGTAATCTCGAGATTACACCAGTTATGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-1850s21c1
Sequence:CCGGTTGGACCGCAATGCGTAATTTCTCGAGAAATTACGCATTGCGGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-454s21c1
Sequence:CCGGGCAGGCTATTAAAGATTTGATCTCGAGATCAAATCTTTAATAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010852
VALIDATED
MYEF2 MISSION shRNA shRNA Plasmid DNA
myelin expression factor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-70s1c1
Sequence:CCGGGCCAATCGGTTCCATCCTTATCTCGAGATAAGGATGGAACCGATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-1355s1c1
Sequence:CCGGGCAACCAGATATTTGTTAGAACTCGAGTTCTAACAAATATCTGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-1432s1c1
Sequence:CCGGCATGTAATGTTTGCAGAGATACTCGAGTATCTCTGCAAACATTACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010852.1-888s1c1
Sequence:CCGGGCTGAACATAACTGGTGTAATCTCGAGATTACACCAGTTATGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-180s1c1
Sequence:CCGGGCAGGCTATTAAAGATTTGATCTCGAGATCAAATCTTTAATAGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-344s21c1
Sequence:CCGGGCCAATCGGTTCCATCCTTATCTCGAGATAAGGATGGAACCGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-1162s21c1
Sequence:CCGGGCTGAACATAACTGGTGTAATCTCGAGATTACACCAGTTATGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-1850s21c1
Sequence:CCGGTTGGACCGCAATGCGTAATTTCTCGAGAAATTACGCATTGCGGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-454s21c1
Sequence:CCGGGCAGGCTATTAAAGATTTGATCTCGAGATCAAATCTTTAATAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010852
VALIDATED
MYEF2 MISSION shRNA Lentiviral Transduction Particles
myelin expression factor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-70s1c1
Sequence:CCGGGCCAATCGGTTCCATCCTTATCTCGAGATAAGGATGGAACCGATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-1355s1c1
Sequence:CCGGGCAACCAGATATTTGTTAGAACTCGAGTTCTAACAAATATCTGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-1432s1c1
Sequence:CCGGCATGTAATGTTTGCAGAGATACTCGAGTATCTCTGCAAACATTACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010852.1-888s1c1
Sequence:CCGGGCTGAACATAACTGGTGTAATCTCGAGATTACACCAGTTATGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010852.1-180s1c1
Sequence:CCGGGCAGGCTATTAAAGATTTGATCTCGAGATCAAATCTTTAATAGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-344s21c1
Sequence:CCGGGCCAATCGGTTCCATCCTTATCTCGAGATAAGGATGGAACCGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-1162s21c1
Sequence:CCGGGCTGAACATAACTGGTGTAATCTCGAGATTACACCAGTTATGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-1850s21c1
Sequence:CCGGTTGGACCGCAATGCGTAATTTCTCGAGAAATTACGCATTGCGGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010852.2-454s21c1
Sequence:CCGGGCAGGCTATTAAAGATTTGATCTCGAGATCAAATCTTTAATAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)