EMAIL THIS PAGE TO A FRIEND

MYEOV2

myeloma overexpressed 2

51 Gene Product Result for
UniProtKB ID: Q8WXC6, Q8N110
Gene ID:
Mouse(66915) myeloma overexpressed 2
Rat(681389) myeloma overexpressed 2
Zebrafish(393820) myeloma overexpressed 2
chicken(770635) myeloma overexpressed 2
dog(100682558) myeloma overexpressed 2
cow(617407) myeloma overexpressed 2
naked mole-rat(101700405) myeloma overexpressed 2
domestic guinea pig(100726221) myeloma overexpressed 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138336 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU169961 MISSION® esiRNA esiRNA targeting mouse Myeov2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138336 Rosetta Predictions human pricing
NM_001109044 Rosetta Predictions rat pricing
XM_888711 Rosetta Predictions mouse pricing
XM_908107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064520 predicted 393
2 SASI_Hs01_00064521 predicted 457
3 SASI_Hs01_00064522 predicted 487
4 SASI_Hs01_00064523 predicted 360
5 SASI_Hs01_00064524 predicted 457
6 SASI_Hs01_00064525 predicted 397
7 SASI_Hs01_00064526 predicted 478
8 SASI_Hs01_00064527 predicted 412
9 SASI_Hs01_00064528 predicted 455
10 SASI_Hs02_00363427 predicted 490
11 SASI_Hs01_00064529 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244584 predicted 206
2 SASI_Rn02_00244585 predicted 193
3 SASI_Rn02_00244586 predicted 206
4 SASI_Rn02_00244587 predicted 179
5 SASI_Rn02_00244588 predicted 268
6 SASI_Rn02_00244589 predicted 255
7 SASI_Rn02_00244590 predicted 194
8 SASI_Rn02_00244591 predicted 96
9 SASI_Rn02_00244592 predicted 269
10 SASI_Rn02_00244593 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257226 predicted 206
2 SASI_Mm01_00257227 predicted 332
3 SASI_Mm01_00257228 predicted 287
4 SASI_Mm01_00257229 predicted 274
5 SASI_Mm01_00257230 predicted 340
6 SASI_Mm01_00257231 predicted 276
7 SASI_Mm01_00257232 predicted 311
8 SASI_Mm01_00257233 predicted 259
9 SASI_Mm01_00257234 predicted 300
10 SASI_Mm01_00257235 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433769 predicted 207
2 SASI_Mm02_00433770 predicted 327
3 SASI_Mm02_00433771 predicted 289
4 SASI_Mm02_00433772 predicted 276
5 SASI_Mm02_00433773 predicted 335
6 SASI_Mm02_00433774 predicted 278
7 SASI_Mm02_00433775 predicted 311
8 SASI_Mm02_00433776 predicted 258
9 SASI_Mm02_00433777 predicted 294
10 SASI_Mm02_00433778 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138336
MYEOV2 MISSION shRNA Bacterial Glycerol Stock
myeloma overexpressed 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-409s1c1
Sequence:CCGGGCAGCTTTGGACAGAGCGTTTCTCGAGAAACGCTCTGTCCAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-374s1c1
Sequence:CCGGCGGAAGAGAGATGTGAACTGACTCGAGTCAGTTCACATCTCTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-587s1c1
Sequence:CCGGGTTATCTAGAGGTGCTCAGAACTCGAGTTCTGAGCACCTCTAGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-461s1c1
Sequence:CCGGCGCTAATGTTTACCAGATGCACTCGAGTGCATCTGGTAAACATTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-457s1c1
Sequence:CCGGGAGGCGCTAATGTTTACCAGACTCGAGTCTGGTAAACATTAGCGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-497s1c1
Sequence:CCGGGTGGCACCAACAAAGCAACAACTCGAGTTGTTGCTTTGTTGGTGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-250s1c1
Sequence:CCGGGATGATGACATCCACAGCTCACTCGAGTGAGCTGTGGATGTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-533s1c1
Sequence:CCGGGCACAGGACGCTTAAGAAACACTCGAGTGTTTCTTAAGCGTCCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-370s1c1
Sequence:CCGGGTGTCGGAAGAGAGATGTGAACTCGAGTTCACATCTCTCTTCCGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-536s1c1
Sequence:CCGGCAGGACGCTTAAGAAACAGTTCTCGAGAACTGTTTCTTAAGCGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138336
MYEOV2 MISSION shRNA shRNA Plasmid DNA
myeloma overexpressed 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-409s1c1
Sequence:CCGGGCAGCTTTGGACAGAGCGTTTCTCGAGAAACGCTCTGTCCAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-374s1c1
Sequence:CCGGCGGAAGAGAGATGTGAACTGACTCGAGTCAGTTCACATCTCTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-587s1c1
Sequence:CCGGGTTATCTAGAGGTGCTCAGAACTCGAGTTCTGAGCACCTCTAGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-461s1c1
Sequence:CCGGCGCTAATGTTTACCAGATGCACTCGAGTGCATCTGGTAAACATTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-457s1c1
Sequence:CCGGGAGGCGCTAATGTTTACCAGACTCGAGTCTGGTAAACATTAGCGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-497s1c1
Sequence:CCGGGTGGCACCAACAAAGCAACAACTCGAGTTGTTGCTTTGTTGGTGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-250s1c1
Sequence:CCGGGATGATGACATCCACAGCTCACTCGAGTGAGCTGTGGATGTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-533s1c1
Sequence:CCGGGCACAGGACGCTTAAGAAACACTCGAGTGTTTCTTAAGCGTCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-370s1c1
Sequence:CCGGGTGTCGGAAGAGAGATGTGAACTCGAGTTCACATCTCTCTTCCGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-536s1c1
Sequence:CCGGCAGGACGCTTAAGAAACAGTTCTCGAGAACTGTTTCTTAAGCGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138336
MYEOV2 MISSION shRNA Lentiviral Transduction Particles
myeloma overexpressed 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-409s1c1
Sequence:CCGGGCAGCTTTGGACAGAGCGTTTCTCGAGAAACGCTCTGTCCAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-374s1c1
Sequence:CCGGCGGAAGAGAGATGTGAACTGACTCGAGTCAGTTCACATCTCTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-587s1c1
Sequence:CCGGGTTATCTAGAGGTGCTCAGAACTCGAGTTCTGAGCACCTCTAGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-461s1c1
Sequence:CCGGCGCTAATGTTTACCAGATGCACTCGAGTGCATCTGGTAAACATTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-457s1c1
Sequence:CCGGGAGGCGCTAATGTTTACCAGACTCGAGTCTGGTAAACATTAGCGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-497s1c1
Sequence:CCGGGTGGCACCAACAAAGCAACAACTCGAGTTGTTGCTTTGTTGGTGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-250s1c1
Sequence:CCGGGATGATGACATCCACAGCTCACTCGAGTGAGCTGTGGATGTCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138336.1-533s1c1
Sequence:CCGGGCACAGGACGCTTAAGAAACACTCGAGTGTTTCTTAAGCGTCCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-370s1c1
Sequence:CCGGGTGTCGGAAGAGAGATGTGAACTCGAGTTCACATCTCTCTTCCGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138336.1-536s1c1
Sequence:CCGGCAGGACGCTTAAGAAACAGTTCTCGAGAACTGTTTCTTAAGCGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)