EMAIL THIS PAGE TO A FRIEND

MYF5

myogenic factor 5

75 Gene Product Result for
Synonyms: bHLHc2
UniProtKB ID: P13349, Q6ISR9
Gene ID:
Mouse(17877) myogenic factor 5
Rat(299766) myogenic factor 5
Goat(100861252) myogenic factor 5
sheep(443159) myogenic factor 5
domestic guinea pig(100718053) myogenic factor 5
naked mole-rat(101717527) myogenic factor 5
Zebrafish(58097) myogenic factor 5
chicken(395633) myogenic factor 5
domestic cat(101091030) myogenic factor 5
cow(281335) myogenic factor 5
dog(482582) myogenic factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025991 MISSION® esiRNA esiRNA human MYF5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005593 Rosetta Predictions human pricing
NM_001106783 Rosetta Predictions rat pricing
NM_008656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072391 predicted 696
2 SASI_Hs02_00339892 predicted 683
3 SASI_Hs02_00339893 predicted 688
4 SASI_Hs01_00072393 predicted 859
5 SASI_Hs01_00072396 predicted 880
6 SASI_Hs02_00339894 predicted 787
7 SASI_Hs02_00339895 predicted 939
8 SASI_Hs02_00339896 predicted 432
9 SASI_Hs02_00339897 predicted 930
10 SASI_Hs02_00339898 predicted 689
11 SASI_Hs01_00072390 predicted 533
12 SASI_Hs01_00072392 predicted 596
13 SASI_Hs01_00072394 predicted 880
14 SASI_Hs01_00072395 predicted 646
15 SASI_Hs01_00072397 predicted 848
16 SASI_Hs01_00072398 predicted 748
17 SASI_Hs01_00072399 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222358 predicted 1259
2 SASI_Rn02_00222359 predicted 765
3 SASI_Rn02_00222360 predicted 1249
4 SASI_Rn02_00222361 predicted 1331
5 SASI_Rn02_00222362 predicted 771
6 SASI_Rn02_00222363 predicted 966
7 SASI_Rn02_00222364 predicted 249
8 SASI_Rn02_00222365 predicted 1460
9 SASI_Rn02_00222366 predicted 979
10 SASI_Rn02_00222367 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126087 predicted 688
2 SASI_Mm01_00126088 predicted 746
3 SASI_Mm01_00126089 predicted 1426
4 SASI_Mm01_00126090 predicted 712
5 SASI_Mm01_00126091 predicted 760
6 SASI_Mm01_00126092 predicted 853
7 SASI_Mm02_00314410 predicted 948
8 SASI_Mm01_00126093 predicted 702
9 SASI_Mm01_00126095 predicted 1464
10 SASI_Mm01_00126096 predicted 1464
11 SASI_Mm01_00126094 predicted 802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005593
MYF5 MISSION shRNA Bacterial Glycerol Stock
myogenic factor 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-602s1c1
Sequence:CCGGGTCCTGATGTATCAAATGTATCTCGAGATACATTTGATACATCAGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-787s1c1
Sequence:CCGGAGGCTTATCTATCATGTGCTACTCGAGTAGCACATGATAGATAAGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-517s1c1
Sequence:CCGGCCCACCTCCAACTGCTCTGATCTCGAGATCAGAGCAGTTGGAGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-746s1c1
Sequence:CCGGGCACCGATTCACAGCCTCGAACTCGAGTTCGAGGCTGTGAATCGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005593.2-1183s21c1
Sequence:CCGGGTTGCAATGCTTAACTTATATCTCGAGATATAAGTTAAGCATTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005593.2-554s21c1
Sequence:CCGGAGCAGGTGGAGAACTACTATACTCGAGTATAGTAGTTCTCCACCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005593
MYF5 MISSION shRNA shRNA Plasmid DNA
myogenic factor 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-602s1c1
Sequence:CCGGGTCCTGATGTATCAAATGTATCTCGAGATACATTTGATACATCAGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-787s1c1
Sequence:CCGGAGGCTTATCTATCATGTGCTACTCGAGTAGCACATGATAGATAAGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-517s1c1
Sequence:CCGGCCCACCTCCAACTGCTCTGATCTCGAGATCAGAGCAGTTGGAGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-746s1c1
Sequence:CCGGGCACCGATTCACAGCCTCGAACTCGAGTTCGAGGCTGTGAATCGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005593.2-1183s21c1
Sequence:CCGGGTTGCAATGCTTAACTTATATCTCGAGATATAAGTTAAGCATTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005593.2-554s21c1
Sequence:CCGGAGCAGGTGGAGAACTACTATACTCGAGTATAGTAGTTCTCCACCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005593
MYF5 MISSION shRNA Lentiviral Transduction Particles
myogenic factor 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-602s1c1
Sequence:CCGGGTCCTGATGTATCAAATGTATCTCGAGATACATTTGATACATCAGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-787s1c1
Sequence:CCGGAGGCTTATCTATCATGTGCTACTCGAGTAGCACATGATAGATAAGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-517s1c1
Sequence:CCGGCCCACCTCCAACTGCTCTGATCTCGAGATCAGAGCAGTTGGAGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005593.1-746s1c1
Sequence:CCGGGCACCGATTCACAGCCTCGAACTCGAGTTCGAGGCTGTGAATCGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005593.2-1183s21c1
Sequence:CCGGGTTGCAATGCTTAACTTATATCTCGAGATATAAGTTAAGCATTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005593.2-554s21c1
Sequence:CCGGAGCAGGTGGAGAACTACTATACTCGAGTATAGTAGTTCTCCACCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008656
MYF5 MISSION shRNA Bacterial Glycerol Stock
myogenic factor 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008656.3-1728s1c1
Sequence:CCGGGCCTTGTAGATATGTATTGAACTCGAGTTCAATACATATCTACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-765s1c1
Sequence:CCGGGTCCTGATGTATCAAATGCATCTCGAGATGCATTTGATACATCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-478s1c1
Sequence:CCGGCGAGCGTAGACGCCTGAAGAACTCGAGTTCTTCAGGCGTCTACGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-948s1c1
Sequence:CCGGCCAGACTTATCTATCACGTATCTCGAGATACGTGATAGATAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-293s1c1
Sequence:CCGGGACCAGTTTGAGCCAAGAGTACTCGAGTACTCTTGGCTCAAACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008656.5-1363s21c1
Sequence:CCGGTTAACAGCTTGGAATCCATTACTCGAGTAATGGATTCCAAGCTGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008656.5-576s21c1
Sequence:CCGGAGGAATGCCATCCGCTACATTCTCGAGAATGTAGCGGATGGCATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008656
MYF5 MISSION shRNA shRNA Plasmid DNA
myogenic factor 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008656.3-1728s1c1
Sequence:CCGGGCCTTGTAGATATGTATTGAACTCGAGTTCAATACATATCTACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-765s1c1
Sequence:CCGGGTCCTGATGTATCAAATGCATCTCGAGATGCATTTGATACATCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-478s1c1
Sequence:CCGGCGAGCGTAGACGCCTGAAGAACTCGAGTTCTTCAGGCGTCTACGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-948s1c1
Sequence:CCGGCCAGACTTATCTATCACGTATCTCGAGATACGTGATAGATAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-293s1c1
Sequence:CCGGGACCAGTTTGAGCCAAGAGTACTCGAGTACTCTTGGCTCAAACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008656.5-1363s21c1
Sequence:CCGGTTAACAGCTTGGAATCCATTACTCGAGTAATGGATTCCAAGCTGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008656.5-576s21c1
Sequence:CCGGAGGAATGCCATCCGCTACATTCTCGAGAATGTAGCGGATGGCATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008656
MYF5 MISSION shRNA Lentiviral Transduction Particles
myogenic factor 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008656.3-1728s1c1
Sequence:CCGGGCCTTGTAGATATGTATTGAACTCGAGTTCAATACATATCTACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-765s1c1
Sequence:CCGGGTCCTGATGTATCAAATGCATCTCGAGATGCATTTGATACATCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-478s1c1
Sequence:CCGGCGAGCGTAGACGCCTGAAGAACTCGAGTTCTTCAGGCGTCTACGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-948s1c1
Sequence:CCGGCCAGACTTATCTATCACGTATCTCGAGATACGTGATAGATAAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008656.3-293s1c1
Sequence:CCGGGACCAGTTTGAGCCAAGAGTACTCGAGTACTCTTGGCTCAAACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008656.5-1363s21c1
Sequence:CCGGTTAACAGCTTGGAATCCATTACTCGAGTAATGGATTCCAAGCTGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008656.5-576s21c1
Sequence:CCGGAGGAATGCCATCCGCTACATTCTCGAGAATGTAGCGGATGGCATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)