EMAIL THIS PAGE TO A FRIEND

MYF6

myogenic factor 6 (herculin)

51 Gene Product Result for
Synonyms: CNM3 MRF4 bHLHc4 myf-6
UniProtKB ID: P23409, B2R898, Q53X80, Q6FHI9
Gene ID:
Human(4618) Summary: The protein encoded by this gene is a probable basic helix-loop-helix (bHLH) DNA binding protein involved in muscle differentiation. The encoded protein likely acts as a heterodimer with another bHLH protein. Defects in this gene are a cause of autosomal dominant centronuclear myopathy (ADCNM). [provided by RefSeq, May 2010]
Mouse(17878) myogenic factor 6
Rat(25714) myogenic factor 6
Zebrafish(404208) myogenic factor 6
domestic cat(101090782) myogenic factor 6 (herculin)
cow(281336) myogenic factor 6 (herculin)
chicken(417873) myogenic factor 6 (herculin)
dog(611531) myogenic factor 6 (herculin)
naked mole-rat(101717176) myogenic factor 6 (herculin)
domestic guinea pig(100719718) myogenic factor 6 (herculin)
Goat(100861258) myogenic factor 6 (herculin)
sheep(100188930) myogenic factor 6 (herculin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002469 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022701 MISSION® esiRNA esiRNA human MYF6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002469 Rosetta Predictions human pricing
NM_013172 Rosetta Predictions rat pricing
NM_008657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238897 predicted 755
2 SASI_Hs01_00238898 predicted 978
3 SASI_Hs01_00238899 predicted 697
4 SASI_Hs01_00238900 predicted 350
5 SASI_Hs02_00333891 predicted 830
6 SASI_Hs01_00238901 predicted 709
7 SASI_Hs01_00238902 predicted 840
8 SASI_Hs01_00238903 predicted 854
9 SASI_Hs01_00238904 predicted 440
10 SASI_Hs01_00238905 predicted 290
11 SASI_Hs01_00238896 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062835 predicted 252
2 SASI_Rn01_00062836 predicted 675
3 SASI_Rn01_00062837 predicted 321
4 SASI_Rn01_00062838 predicted 391
5 SASI_Rn01_00062839 predicted 651
6 SASI_Rn01_00062840 predicted 481
7 SASI_Rn01_00062841 predicted 698
8 SASI_Rn02_00260994 predicted 589
9 SASI_Rn01_00062842 predicted 598
10 SASI_Rn02_00260995 predicted 750
11 SASI_Rn01_00062843 predicted 583
12 SASI_Rn01_00062844 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077345 predicted 432
2 SASI_Mm02_00314411 predicted 942
3 SASI_Mm01_00077347 predicted 325
4 SASI_Mm01_00077348 predicted 799
5 SASI_Mm01_00077349 predicted 609
6 SASI_Mm01_00077350 predicted 410
7 SASI_Mm01_00077351 predicted 577
8 SASI_Mm01_00077352 predicted 518
9 SASI_Mm01_00077353 predicted 534
10 SASI_Mm02_00314412 predicted 679
11 SASI_Mm01_00077346 predicted 953
12 SASI_Mm01_00077354 predicted 883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002469
MYF6 MISSION shRNA Bacterial Glycerol Stock
myogenic factor 6 (herculin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-353s1c1
Sequence:CCGGGCGCGAAAGGAGGAGGCTAAACTCGAGTTTAGCCTCCTCCTTTCGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-694s1c1
Sequence:CCGGGTAGCCTTCGATGCCTTTCTTCTCGAGAAGAAAGGCATCGAAGGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002469.1-837s1c1
Sequence:CCGGCCTGGCCTAATCCTTTAGATTCTCGAGAATCTAAAGGATTAGGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-120s1c1
Sequence:CCGGCAGCCATTAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTAATGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-642s1c1
Sequence:CCGGCTCGTGATAACGGCTAAGGAACTCGAGTTCCTTAGCCGTTATCACGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002469.1-904s21c1
Sequence:CCGGGAAAGGGAAGGAGACACATTCCTCGAGGAATGTGTCTCCTTCCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002469.1-952s21c1
Sequence:CCGGATCTGTTGTGCACGCTCAAATCTCGAGATTTGAGCGTGCACAACAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002469.1-614s21c1
Sequence:CCGGGCCAAGTGTTTCCGATCATTCCTCGAGGAATGATCGGAAACACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002469
MYF6 MISSION shRNA shRNA Plasmid DNA
myogenic factor 6 (herculin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-353s1c1
Sequence:CCGGGCGCGAAAGGAGGAGGCTAAACTCGAGTTTAGCCTCCTCCTTTCGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-694s1c1
Sequence:CCGGGTAGCCTTCGATGCCTTTCTTCTCGAGAAGAAAGGCATCGAAGGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002469.1-837s1c1
Sequence:CCGGCCTGGCCTAATCCTTTAGATTCTCGAGAATCTAAAGGATTAGGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-120s1c1
Sequence:CCGGCAGCCATTAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTAATGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-642s1c1
Sequence:CCGGCTCGTGATAACGGCTAAGGAACTCGAGTTCCTTAGCCGTTATCACGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002469.1-904s21c1
Sequence:CCGGGAAAGGGAAGGAGACACATTCCTCGAGGAATGTGTCTCCTTCCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002469.1-952s21c1
Sequence:CCGGATCTGTTGTGCACGCTCAAATCTCGAGATTTGAGCGTGCACAACAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002469.1-614s21c1
Sequence:CCGGGCCAAGTGTTTCCGATCATTCCTCGAGGAATGATCGGAAACACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002469
MYF6 MISSION shRNA Lentiviral Transduction Particles
myogenic factor 6 (herculin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-353s1c1
Sequence:CCGGGCGCGAAAGGAGGAGGCTAAACTCGAGTTTAGCCTCCTCCTTTCGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-694s1c1
Sequence:CCGGGTAGCCTTCGATGCCTTTCTTCTCGAGAAGAAAGGCATCGAAGGCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002469.1-837s1c1
Sequence:CCGGCCTGGCCTAATCCTTTAGATTCTCGAGAATCTAAAGGATTAGGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-120s1c1
Sequence:CCGGCAGCCATTAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTAATGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002469.1-642s1c1
Sequence:CCGGCTCGTGATAACGGCTAAGGAACTCGAGTTCCTTAGCCGTTATCACGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002469.1-904s21c1
Sequence:CCGGGAAAGGGAAGGAGACACATTCCTCGAGGAATGTGTCTCCTTCCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002469.1-952s21c1
Sequence:CCGGATCTGTTGTGCACGCTCAAATCTCGAGATTTGAGCGTGCACAACAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002469.1-614s21c1
Sequence:CCGGGCCAAGTGTTTCCGATCATTCCTCGAGGAATGATCGGAAACACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008657
VALIDATED
MYF6 MISSION shRNA Bacterial Glycerol Stock
myogenic factor 6 (herculin)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-1078s21c1
Sequence:CCGGATCAAAGAGAGAACGTTTAATCTCGAGATTAAACGTTCTCTCTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-119s1c1
Sequence:CCGGCCTTTGTATCCAGGGAGTGATCTCGAGATCACTCCCTGGATACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-328s1c1
Sequence:CCGGCGAAAGGAGGAGACTAAAGAACTCGAGTTCTTTAGTCTCCTCCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008657.1-1058s1c1
Sequence:CCGGCGAAGTTCATTCCTGTCTAAACTCGAGTTTAGACAGGAATGAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-521s1c1
Sequence:CCGGAGCTACAAACCCAAGCAAGAACTCGAGTTCTTGCTTGGGTTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008657.1-60s1c1
Sequence:CCGGTCTTCTACTTAGATGGAGAAACTCGAGTTTCTCCATCTAAGTAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008657.2-326s21c1
Sequence:CCGGCGCGAAAGGAGGAGACTAAAGCTCGAGCTTTAGTCTCCTCCTTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-586s21c1
Sequence:CCGGGCCAAGTGTTTCGGATCATTCCTCGAGGAATGATCCGAAACACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-542s21c1
Sequence:CCGGATTCTTGAGGGTGCGGATTTCCTCGAGGAAATCCGCACCCTCAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-684s21c1
Sequence:CCGGCTTCCATCGTGGACAGTATTTCTCGAGAAATACTGTCCACGATGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008657
VALIDATED
MYF6 MISSION shRNA shRNA Plasmid DNA
myogenic factor 6 (herculin)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-1078s21c1
Sequence:CCGGATCAAAGAGAGAACGTTTAATCTCGAGATTAAACGTTCTCTCTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-119s1c1
Sequence:CCGGCCTTTGTATCCAGGGAGTGATCTCGAGATCACTCCCTGGATACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-328s1c1
Sequence:CCGGCGAAAGGAGGAGACTAAAGAACTCGAGTTCTTTAGTCTCCTCCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008657.1-1058s1c1
Sequence:CCGGCGAAGTTCATTCCTGTCTAAACTCGAGTTTAGACAGGAATGAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-521s1c1
Sequence:CCGGAGCTACAAACCCAAGCAAGAACTCGAGTTCTTGCTTGGGTTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008657.1-60s1c1
Sequence:CCGGTCTTCTACTTAGATGGAGAAACTCGAGTTTCTCCATCTAAGTAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008657.2-326s21c1
Sequence:CCGGCGCGAAAGGAGGAGACTAAAGCTCGAGCTTTAGTCTCCTCCTTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-586s21c1
Sequence:CCGGGCCAAGTGTTTCGGATCATTCCTCGAGGAATGATCCGAAACACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-542s21c1
Sequence:CCGGATTCTTGAGGGTGCGGATTTCCTCGAGGAAATCCGCACCCTCAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-684s21c1
Sequence:CCGGCTTCCATCGTGGACAGTATTTCTCGAGAAATACTGTCCACGATGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008657
VALIDATED
MYF6 MISSION shRNA Lentiviral Transduction Particles
myogenic factor 6 (herculin)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-1078s21c1
Sequence:CCGGATCAAAGAGAGAACGTTTAATCTCGAGATTAAACGTTCTCTCTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-119s1c1
Sequence:CCGGCCTTTGTATCCAGGGAGTGATCTCGAGATCACTCCCTGGATACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-328s1c1
Sequence:CCGGCGAAAGGAGGAGACTAAAGAACTCGAGTTCTTTAGTCTCCTCCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008657.1-1058s1c1
Sequence:CCGGCGAAGTTCATTCCTGTCTAAACTCGAGTTTAGACAGGAATGAACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008657.1-521s1c1
Sequence:CCGGAGCTACAAACCCAAGCAAGAACTCGAGTTCTTGCTTGGGTTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008657.1-60s1c1
Sequence:CCGGTCTTCTACTTAGATGGAGAAACTCGAGTTTCTCCATCTAAGTAGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008657.2-326s21c1
Sequence:CCGGCGCGAAAGGAGGAGACTAAAGCTCGAGCTTTAGTCTCCTCCTTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-586s21c1
Sequence:CCGGGCCAAGTGTTTCGGATCATTCCTCGAGGAATGATCCGAAACACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-542s21c1
Sequence:CCGGATTCTTGAGGGTGCGGATTTCCTCGAGGAAATCCGCACCCTCAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008657.2-684s21c1
Sequence:CCGGCTTCCATCGTGGACAGTATTTCTCGAGAAATACTGTCCACGATGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)