EMAIL THIS PAGE TO A FRIEND

MYH13

myosin, heavy chain 13, skeletal muscle

74 Gene Product Result for
Synonyms: MyHC-eo
UniProtKB ID: Q9UKX3, O95252
Gene ID:
Mouse(544791) myosin, heavy polypeptide 13, skeletal muscle
Rat(29605) myosin, heavy chain 13, skeletal muscle
chicken(768487) myosin, heavy chain 13, skeletal muscle
dog(489503) myosin, heavy chain 13, skeletal muscle
domestic cat(101083886) myosin, heavy chain 13, skeletal muscle
Horse(100062865) myosin, heavy chain 13, skeletal muscle
cow(511687) myosin, heavy chain 13, skeletal muscle
sheep(101103165) myosin, heavy chain 13, skeletal muscle
Domestic Rabbit(100302407) myosin, heavy chain 13, skeletal muscle
naked mole-rat(101697541) myosin, heavy chain 13, skeletal muscle
domestic guinea pig(100725899) myosin, heavy chain 13, skeletal muscle
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M7523 Anti-Myosin (Skeletal) antibody produced in rabbit whole antiserum human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003802 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003802 Rosetta Predictions human pricing
XM_001078857 Rosetta Predictions rat pricing
XM_001080189 Rosetta Predictions rat pricing
XM_340820 Rosetta Predictions rat pricing
NM_001081250 Rosetta Predictions mouse pricing
XM_618893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203884 predicted 3901
2 SASI_Hs01_00203885 predicted 875
3 SASI_Hs02_00336329 predicted 4659
4 SASI_Hs02_00336330 predicted 2098
5 SASI_Hs02_00336331 predicted 2200
6 SASI_Hs01_00203888 predicted 1247
7 SASI_Hs01_00203889 predicted 5492
8 SASI_Hs01_00203890 predicted 610
9 SASI_Hs02_00336332 predicted 1234
10 SASI_Hs02_00336333 predicted 5250
11 SASI_Hs01_00203881 predicted 3350
12 SASI_Hs01_00203882 predicted 3375
13 SASI_Hs01_00203883 predicted 1087
14 SASI_Hs01_00203886 predicted 5670
15 SASI_Hs01_00203887 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362242 predicted 3300
2 SASI_Rn02_00362243 predicted 904
3 SASI_Rn02_00362244 predicted 3821
4 SASI_Rn02_00362245 predicted 3386
5 SASI_Rn02_00362246 predicted 4711
6 SASI_Rn02_00362247 predicted 2605
7 SASI_Rn02_00362248 predicted 3075
8 SASI_Rn02_00362249 predicted 1991
9 SASI_Rn02_00362250 predicted 2020
10 SASI_Rn02_00362251 predicted 4814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366998 predicted 2949
2 SASI_Rn02_00366999 predicted 555
3 SASI_Rn02_00367000 predicted 3477
4 SASI_Rn02_00367001 predicted 3038
5 SASI_Rn02_00367002 predicted 4361
6 SASI_Rn02_00367003 predicted 2254
7 SASI_Rn02_00367004 predicted 2728
8 SASI_Rn02_00367005 predicted 1641
9 SASI_Rn02_00367006 predicted 1672
10 SASI_Rn02_00367007 predicted 4460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189847 predicted 3328
2 SASI_Rn01_00189848 predicted 3850
3 SASI_Rn01_00189849 predicted 246
4 SASI_Rn01_00189850 predicted 3417
5 SASI_Rn01_00189851 predicted 4742
6 SASI_Rn01_00189852 predicted 2627
7 SASI_Rn01_00189853 predicted 3109
8 SASI_Rn01_00189854 predicted 2024
9 SASI_Rn01_00189855 predicted 214
10 SASI_Rn01_00189856 predicted 2052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296637 predicted 1000
2 SASI_Mm02_00296638 predicted 815
3 SASI_Mm02_00296639 predicted 4690
4 SASI_Mm02_00296640 predicted 1151
5 SASI_Mm02_00296641 predicted 1971
6 SASI_Mm02_00296642 predicted 2967
7 SASI_Mm02_00296643 predicted 505
8 SASI_Mm02_00296644 predicted 3272
9 SASI_Mm02_00296645 predicted 4796
10 SASI_Mm02_00296646 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_618893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205948 predicted 3265
2 SASI_Mm01_00205949 predicted 4704
3 SASI_Mm01_00205950 predicted 2016
4 SASI_Mm01_00205951 predicted 4682
5 SASI_Mm01_00205952 predicted 1984
6 SASI_Mm01_00205953 predicted 2679
7 SASI_Mm01_00205954 predicted 2967
8 SASI_Mm01_00205955 predicted 3278
9 SASI_Mm01_00205956 predicted 4799
10 SASI_Mm01_00205957 predicted 4528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003802
MYH13 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 13, skeletal muscle
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003802.1-4540s1c1
Sequence:CCGGGAACTCTTCAAGATGAGGAATCTCGAGATTCCTCATCTTGAAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003802.1-178s1c1
Sequence:CCGGCGTCCATTCGATTCCAAGAAACTCGAGTTTCTTGGAATCGAATGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3849s21c1
Sequence:CCGGCCGGACGGTAGAAGATCAATTCTCGAGAATTGATCTTCTACCGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3283s21c1
Sequence:CCGGATGTCCCAGGAATCCATTATGCTCGAGCATAATGGATTCCTGGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-874s21c1
Sequence:CCGGTCGGCAGACATCGAAACTTATCTCGAGATAAGTTTCGATGTCTGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-200s21c1
Sequence:CCGGCCTGCTTTGTAGCGGATAATACTCGAGTATTATCCGCTACAAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3144s21c1
Sequence:CCGGAGATAAAGTCAATGGTCTAATCTCGAGATTAGACCATTGACTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003802
MYH13 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 13, skeletal muscle
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003802.1-4540s1c1
Sequence:CCGGGAACTCTTCAAGATGAGGAATCTCGAGATTCCTCATCTTGAAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003802.1-178s1c1
Sequence:CCGGCGTCCATTCGATTCCAAGAAACTCGAGTTTCTTGGAATCGAATGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3849s21c1
Sequence:CCGGCCGGACGGTAGAAGATCAATTCTCGAGAATTGATCTTCTACCGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3283s21c1
Sequence:CCGGATGTCCCAGGAATCCATTATGCTCGAGCATAATGGATTCCTGGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-874s21c1
Sequence:CCGGTCGGCAGACATCGAAACTTATCTCGAGATAAGTTTCGATGTCTGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-200s21c1
Sequence:CCGGCCTGCTTTGTAGCGGATAATACTCGAGTATTATCCGCTACAAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3144s21c1
Sequence:CCGGAGATAAAGTCAATGGTCTAATCTCGAGATTAGACCATTGACTTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003802
MYH13 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 13, skeletal muscle
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003802.1-4540s1c1
Sequence:CCGGGAACTCTTCAAGATGAGGAATCTCGAGATTCCTCATCTTGAAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003802.1-178s1c1
Sequence:CCGGCGTCCATTCGATTCCAAGAAACTCGAGTTTCTTGGAATCGAATGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3849s21c1
Sequence:CCGGCCGGACGGTAGAAGATCAATTCTCGAGAATTGATCTTCTACCGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3283s21c1
Sequence:CCGGATGTCCCAGGAATCCATTATGCTCGAGCATAATGGATTCCTGGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-874s21c1
Sequence:CCGGTCGGCAGACATCGAAACTTATCTCGAGATAAGTTTCGATGTCTGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-200s21c1
Sequence:CCGGCCTGCTTTGTAGCGGATAATACTCGAGTATTATCCGCTACAAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003802.2-3144s21c1
Sequence:CCGGAGATAAAGTCAATGGTCTAATCTCGAGATTAGACCATTGACTTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081250
MYH13 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 13, skeletal muscle
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-3762s21c1
Sequence:CCGGGTCTGTGGAAGACCAATTTAACTCGAGTTAAATTGGTCTTCCACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-2080s21c1
Sequence:CCGGATGCATCAGCTGCGCTGTAATCTCGAGATTACAGCGCAGCTGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-495s21c1
Sequence:CCGGCATGCTAACAGATCGAGATAACTCGAGTTATCTCGATCTGTTAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-973s21c1
Sequence:CCGGATCGATGACAGCGAGGAATTGCTCGAGCAATTCCTCGCTGTCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-3801s21c1
Sequence:CCGGTGACCAACAGACCCAGTTAATCTCGAGATTAACTGGGTCTGTTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081250
MYH13 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 13, skeletal muscle
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-3762s21c1
Sequence:CCGGGTCTGTGGAAGACCAATTTAACTCGAGTTAAATTGGTCTTCCACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-2080s21c1
Sequence:CCGGATGCATCAGCTGCGCTGTAATCTCGAGATTACAGCGCAGCTGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-495s21c1
Sequence:CCGGCATGCTAACAGATCGAGATAACTCGAGTTATCTCGATCTGTTAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-973s21c1
Sequence:CCGGATCGATGACAGCGAGGAATTGCTCGAGCAATTCCTCGCTGTCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-3801s21c1
Sequence:CCGGTGACCAACAGACCCAGTTAATCTCGAGATTAACTGGGTCTGTTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081250
MYH13 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 13, skeletal muscle
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-3762s21c1
Sequence:CCGGGTCTGTGGAAGACCAATTTAACTCGAGTTAAATTGGTCTTCCACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-2080s21c1
Sequence:CCGGATGCATCAGCTGCGCTGTAATCTCGAGATTACAGCGCAGCTGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-495s21c1
Sequence:CCGGCATGCTAACAGATCGAGATAACTCGAGTTATCTCGATCTGTTAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-973s21c1
Sequence:CCGGATCGATGACAGCGAGGAATTGCTCGAGCAATTCCTCGCTGTCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081250.1-3801s21c1
Sequence:CCGGTGACCAACAGACCCAGTTAATCTCGAGATTAACTGGGTCTGTTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)