EMAIL THIS PAGE TO A FRIEND

MYH14

myosin, heavy chain 14, non-muscle

51 Gene Product Result for
Synonyms: DFNA4 DFNA4A MHC16 MYH17 NMHC II-C NMHC-II-C PNMHH myosin
Gene ID:
Human(79784) Summary: This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-14 (MYO14). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene result in one form of autosomal dominant hearing impairment. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(71960) myosin, heavy polypeptide 14
Rat(308572) myosin, heavy chain 14, non-muscle
domestic guinea pig(100720407) myosin, heavy chain 14, non-muscle
naked mole-rat(101702742) myosin, heavy chain 14, non-muscle
sheep(101115985) myosin, heavy chain 14, non-muscle
Zebrafish(563011) myosin, heavy chain 14, non-muscle
Horse(100630525) myosin, heavy chain 14, non-muscle
cow(514212) myosin, heavy chain 14, non-muscle
domestic cat(101099674) myosin, heavy chain 14, non-muscle
dog(100688336) myosin, heavy chain 14, non-muscle
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024729 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077186 Rosetta Predictions human pricing
NM_024729 Rosetta Predictions human pricing
NM_001100690 Rosetta Predictions rat pricing
NM_028021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312114 predicted 3193
2 SASI_Hs02_00312115 predicted 502
3 SASI_Hs02_00312116 predicted 1761
4 SASI_Hs02_00312117 predicted 5653
5 SASI_Hs02_00312118 predicted 2930
6 SASI_Hs02_00312119 predicted 483
7 SASI_Hs02_00312120 predicted 4973
8 SASI_Hs02_00312121 predicted 1323
9 SASI_Hs02_00312122 predicted 1295
10 SASI_Hs02_00312123 predicted 5291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221168 predicted 3162
2 SASI_Hs01_00221170 predicted 498
3 SASI_Hs01_00221171 predicted 1736
4 SASI_Hs01_00221172 predicted 5637
5 SASI_Hs01_00221173 predicted 2903
6 SASI_Hs01_00221174 predicted 480
7 SASI_Hs01_00221175 predicted 4949
8 SASI_Hs01_00221176 predicted 1299
9 SASI_Hs01_00221177 predicted 1271
10 SASI_Hs02_00357204 predicted 5273
11 SASI_Hs01_00221169 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210308 predicted 459
2 SASI_Rn02_00210309 predicted 4504
3 SASI_Rn02_00210310 predicted 4954
4 SASI_Rn02_00210311 predicted 837
5 SASI_Rn02_00210312 predicted 474
6 SASI_Rn02_00210313 predicted 4441
7 SASI_Rn02_00210314 predicted 938
8 SASI_Rn02_00210315 predicted 3166
9 SASI_Rn02_00210316 predicted 408
10 SASI_Rn02_00210317 predicted 2554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130980 predicted 877
2 SASI_Mm01_00130981 predicted 293
3 SASI_Mm01_00130982 predicted 2385
4 SASI_Mm01_00130983 predicted 781
5 SASI_Mm01_00130984 predicted 371
6 SASI_Mm01_00130985 predicted 1250
7 SASI_Mm01_00130986 predicted 5348
8 SASI_Mm01_00130987 predicted 426
9 SASI_Mm01_00130989 predicted 4385
10 SASI_Mm02_00333158 predicted 4754
11 SASI_Mm01_00130988 predicted 5363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024729
VALIDATED
MYH14 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 14, non-muscle
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024729.3-794s21c1
Sequence:CCGGCAATGCCAAGACAGTGAAGAACTCGAGTTCTTCACTGTCTTGGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-1112s21c1
Sequence:CCGGGGGATTCAGCCACGAGGAAATCTCGAGATTTCCTCGTGGCTGAATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024729.3-6150s21c1
Sequence:CCGGGTGCAGCACTCTGGCATTTATCTCGAGATAAATGCCAGAGTGCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-1169s1c1
Sequence:CCGGGTTTGGCAACATTGCCTTGAACTCGAGTTCAAGGCAATGTTGCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024729.2-3170s1c1
Sequence:CCGGCTCAATAAGCTACGGCTCAAACTCGAGTTTGAGCCGTAGCTTATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024729.2-6322s1c1
Sequence:CCGGCTCCTTTCTTCCCTCGTTATTCTCGAGAATAACGAGGGAAGAAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-794s1c1
Sequence:CCGGCAATGCCAAGACAGTGAAGAACTCGAGTTCTTCACTGTCTTGGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-3184s1c1
Sequence:CCGGGCTCAAATATGAGGCCACAATCTCGAGATTGTGGCCTCATATTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-5634s21c1
Sequence:CCGGAGAGCTGAGAAGCGGCTTAAACTCGAGTTTAAGCCGCTTCTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-4438s21c1
Sequence:CCGGAGAAGAAGCAGCGCAAGTTTGCTCGAGCAAACTTGCGCTGCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024729
VALIDATED
MYH14 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 14, non-muscle
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024729.3-794s21c1
Sequence:CCGGCAATGCCAAGACAGTGAAGAACTCGAGTTCTTCACTGTCTTGGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-1112s21c1
Sequence:CCGGGGGATTCAGCCACGAGGAAATCTCGAGATTTCCTCGTGGCTGAATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024729.3-6150s21c1
Sequence:CCGGGTGCAGCACTCTGGCATTTATCTCGAGATAAATGCCAGAGTGCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-1169s1c1
Sequence:CCGGGTTTGGCAACATTGCCTTGAACTCGAGTTCAAGGCAATGTTGCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024729.2-3170s1c1
Sequence:CCGGCTCAATAAGCTACGGCTCAAACTCGAGTTTGAGCCGTAGCTTATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024729.2-6322s1c1
Sequence:CCGGCTCCTTTCTTCCCTCGTTATTCTCGAGAATAACGAGGGAAGAAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-794s1c1
Sequence:CCGGCAATGCCAAGACAGTGAAGAACTCGAGTTCTTCACTGTCTTGGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-3184s1c1
Sequence:CCGGGCTCAAATATGAGGCCACAATCTCGAGATTGTGGCCTCATATTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-5634s21c1
Sequence:CCGGAGAGCTGAGAAGCGGCTTAAACTCGAGTTTAAGCCGCTTCTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-4438s21c1
Sequence:CCGGAGAAGAAGCAGCGCAAGTTTGCTCGAGCAAACTTGCGCTGCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024729
VALIDATED
MYH14 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 14, non-muscle
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024729.3-794s21c1
Sequence:CCGGCAATGCCAAGACAGTGAAGAACTCGAGTTCTTCACTGTCTTGGCATTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000285308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-1112s21c1
Sequence:CCGGGGGATTCAGCCACGAGGAAATCTCGAGATTTCCTCGTGGCTGAATCCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024729.3-6150s21c1
Sequence:CCGGGTGCAGCACTCTGGCATTTATCTCGAGATAAATGCCAGAGTGCTGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-1169s1c1
Sequence:CCGGGTTTGGCAACATTGCCTTGAACTCGAGTTCAAGGCAATGTTGCCAAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000148431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024729.2-3170s1c1
Sequence:CCGGCTCAATAAGCTACGGCTCAAACTCGAGTTTGAGCCGTAGCTTATTGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000146426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024729.2-6322s1c1
Sequence:CCGGCTCCTTTCTTCCCTCGTTATTCTCGAGAATAACGAGGGAAGAAAGGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000148318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-794s1c1
Sequence:CCGGCAATGCCAAGACAGTGAAGAACTCGAGTTCTTCACTGTCTTGGCATTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024729.2-3184s1c1
Sequence:CCGGGCTCAAATATGAGGCCACAATCTCGAGATTGTGGCCTCATATTTGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-5634s21c1
Sequence:CCGGAGAGCTGAGAAGCGGCTTAAACTCGAGTTTAAGCCGCTTCTCAGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024729.3-4438s21c1
Sequence:CCGGAGAAGAAGCAGCGCAAGTTTGCTCGAGCAAACTTGCGCTGCTTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028021
MYH14 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 14, non-muscle
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028021.1-6032s1c1
Sequence:CCGGCCTCCTGGTTTGCACTTTGAACTCGAGTTCAAAGTGCAAACCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-5317s1c1
Sequence:CCGGCATTACCGAAAGCTAGTGCTACTCGAGTAGCACTAGCTTTCGGTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-2403s1c1
Sequence:CCGGCACCGACATCATAGTGTCTTTCTCGAGAAAGACACTATGATGTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-1116s1c1
Sequence:CCGGGTTTGGCAACATTGTCCTGAACTCGAGTTCAGGACAATGTTGCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-386s1c1
Sequence:CCGGCCGGGCTCATTTATACCTACTCTCGAGAGTAGGTATAAATGAGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028021
MYH14 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 14, non-muscle
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028021.1-6032s1c1
Sequence:CCGGCCTCCTGGTTTGCACTTTGAACTCGAGTTCAAAGTGCAAACCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-5317s1c1
Sequence:CCGGCATTACCGAAAGCTAGTGCTACTCGAGTAGCACTAGCTTTCGGTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-2403s1c1
Sequence:CCGGCACCGACATCATAGTGTCTTTCTCGAGAAAGACACTATGATGTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-1116s1c1
Sequence:CCGGGTTTGGCAACATTGTCCTGAACTCGAGTTCAGGACAATGTTGCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-386s1c1
Sequence:CCGGCCGGGCTCATTTATACCTACTCTCGAGAGTAGGTATAAATGAGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028021
MYH14 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 14, non-muscle
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028021.1-6032s1c1
Sequence:CCGGCCTCCTGGTTTGCACTTTGAACTCGAGTTCAAAGTGCAAACCAGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-5317s1c1
Sequence:CCGGCATTACCGAAAGCTAGTGCTACTCGAGTAGCACTAGCTTTCGGTAATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-2403s1c1
Sequence:CCGGCACCGACATCATAGTGTCTTTCTCGAGAAAGACACTATGATGTCGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-1116s1c1
Sequence:CCGGGTTTGGCAACATTGTCCTGAACTCGAGTTCAGGACAATGTTGCCAAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028021.1-386s1c1
Sequence:CCGGCCGGGCTCATTTATACCTACTCTCGAGAGTAGGTATAAATGAGCCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???