EMAIL THIS PAGE TO A FRIEND

MYH15

myosin, heavy chain 15

80 Gene Product Result for
UniProtKB ID: Q9Y2K3
Gene ID:
Mouse(667772) myosin, heavy chain 15
Rat(303965) myosin, heavy chain 15
chicken(395534) myosin, heavy chain 15
cow(526674) myosin, heavy chain 15
Horse(100071848) myosin, heavy chain 15
domestic cat(101083538) myosin, heavy chain 15
dog(487967) myosin, heavy chain 15
sheep(101111932) myosin, heavy chain 15
Domestic Rabbit(100354450) myosin, heavy chain 15
domestic guinea pig(100728611) myosin, heavy chain 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014981 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025581 MISSION® esiRNA esiRNA human MYH15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014981 Rosetta Predictions human pricing
XM_036988 Rosetta Predictions human pricing
XM_001064527 Rosetta Predictions rat pricing
XM_221489 Rosetta Predictions rat pricing
XM_001002743 Rosetta Predictions mouse pricing
XM_992311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346711 predicted 1296
2 SASI_Hs02_00346712 predicted 1600
3 SASI_Hs02_00346713 predicted 928
4 SASI_Hs02_00346714 predicted 3047
5 SASI_Hs02_00346715 predicted 5121
6 SASI_Hs02_00346716 predicted 1267
7 SASI_Hs02_00346717 predicted 2069
8 SASI_Hs02_00346718 predicted 4005
9 SASI_Hs02_00346719 predicted 2588
10 SASI_Hs02_00346720 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_036988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288325 predicted 2430
2 SASI_Hs01_00288326 predicted 1293
3 SASI_Hs01_00288327 predicted 1601
4 SASI_Hs01_00288328 predicted 933
5 SASI_Hs01_00288329 predicted 3045
6 SASI_Hs01_00288330 predicted 5121
7 SASI_Hs01_00288331 predicted 2075
8 SASI_Hs01_00288332 predicted 2596
9 SASI_Hs01_00288333 predicted 4108
10 SASI_Hs01_00288334 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310859 predicted 2901
2 SASI_Rn02_00310860 predicted 261
3 SASI_Rn02_00310861 predicted 5424
4 SASI_Rn02_00310862 predicted 3879
5 SASI_Rn02_00310863 predicted 1232
6 SASI_Rn02_00310864 predicted 4628
7 SASI_Rn02_00310865 predicted 4165
8 SASI_Rn02_00310866 predicted 1856
9 SASI_Rn02_00310867 predicted 1324
10 SASI_Rn02_00310868 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122744 predicted 3303
2 SASI_Rn01_00122745 predicted 2963
3 SASI_Rn01_00122746 predicted 317
4 SASI_Rn01_00122747 predicted 1278
5 SASI_Rn01_00122748 predicted 1301
6 SASI_Rn01_00122749 predicted 382
7 SASI_Rn01_00122750 predicted 1916
8 SASI_Rn01_00122751 predicted 1324
9 SASI_Rn01_00122752 predicted 1371
10 SASI_Rn01_00122753 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355579 predicted 583
2 SASI_Mm02_00355580 predicted 1494
3 SASI_Mm02_00355581 predicted 748
4 SASI_Mm02_00355582 predicted 2051
5 SASI_Mm02_00355583 predicted 1751
6 SASI_Mm02_00355584 predicted 1214
7 SASI_Mm02_00355585 predicted 1803
8 SASI_Mm02_00355586 predicted 4521
9 SASI_Mm02_00355587 predicted 1171
10 SASI_Mm02_00355588 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451055 predicted 584
2 SASI_Mm02_00451056 predicted 1495
3 SASI_Mm02_00451057 predicted 757
4 SASI_Mm02_00451058 predicted 2049
5 SASI_Mm02_00451059 predicted 1757
6 SASI_Mm02_00451060 predicted 1215
7 SASI_Mm02_00451061 predicted 1810
8 SASI_Mm02_00451062 predicted 4524
9 SASI_Mm02_00451063 predicted 1171
10 SASI_Mm02_00451064 predicted 1882
11 SASI_Mm01_00260276 predicted 5553
12 SASI_Mm01_00260277 predicted 5363
13 SASI_Mm01_00260278 predicted 5403
14 SASI_Mm01_00260279 predicted 5604
15 SASI_Mm01_00260280 predicted 5232
16 SASI_Mm01_00260281 predicted 5134
17 SASI_Mm01_00260282 predicted 5373
18 SASI_Mm01_00260283 predicted 5365
19 SASI_Mm01_00260284 predicted 5210
20 SASI_Mm01_00260285 predicted 5555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014981
MYH15 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-3251s21c1
Sequence:CCGGACAAACTGGAGGGCAATTTAACTCGAGTTAAATTGCCCTCCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-2803s21c1
Sequence:CCGGCAGTGCGAGTGGCTGATTAAACTCGAGTTTAATCAGCCACTCGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-1126s21c1
Sequence:CCGGGAGAAGTATGGATGCTATAAACTCGAGTTTATAGCATCCATACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014981.1-6188s21c1
Sequence:CCGGCTTGATCCTTTGTCCATATTTCTCGAGAAATATGGACAAAGGATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-1606s21c1
Sequence:CCGGAGCATTGAATGGGTGTCTATTCTCGAGAATAGACACCCATTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014981
MYH15 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-3251s21c1
Sequence:CCGGACAAACTGGAGGGCAATTTAACTCGAGTTAAATTGCCCTCCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-2803s21c1
Sequence:CCGGCAGTGCGAGTGGCTGATTAAACTCGAGTTTAATCAGCCACTCGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-1126s21c1
Sequence:CCGGGAGAAGTATGGATGCTATAAACTCGAGTTTATAGCATCCATACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014981.1-6188s21c1
Sequence:CCGGCTTGATCCTTTGTCCATATTTCTCGAGAAATATGGACAAAGGATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-1606s21c1
Sequence:CCGGAGCATTGAATGGGTGTCTATTCTCGAGAATAGACACCCATTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014981
MYH15 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-3251s21c1
Sequence:CCGGACAAACTGGAGGGCAATTTAACTCGAGTTAAATTGCCCTCCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-2803s21c1
Sequence:CCGGCAGTGCGAGTGGCTGATTAAACTCGAGTTTAATCAGCCACTCGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-1126s21c1
Sequence:CCGGGAGAAGTATGGATGCTATAAACTCGAGTTTATAGCATCCATACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014981.1-6188s21c1
Sequence:CCGGCTTGATCCTTTGTCCATATTTCTCGAGAAATATGGACAAAGGATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014981.1-1606s21c1
Sequence:CCGGAGCATTGAATGGGTGTCTATTCTCGAGAATAGACACCCATTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)