EMAIL THIS PAGE TO A FRIEND

MYH1

myosin, heavy chain 1, skeletal muscle, adult

72 Gene Product Result for
Synonyms: MYHSA1 MYHa MyHC-2X/D MyHC-2x
UniProtKB ID: P12882, Q14CA4, Q9Y622
Gene ID:
Human(4619) Summary: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
Mouse(17879) myosin, heavy polypeptide 1, skeletal muscle, adult
Rat(287408) myosin, heavy chain 1, skeletal muscle, adult
domestic guinea pig(100726730) myosin, heavy chain 1, skeletal muscle, adult
naked mole-rat(101700700) myosin, heavy chain 1, skeletal muscle, adult
Domestic Rabbit(100303760) myosin, heavy chain 1, skeletal muscle, adult
Horse(791235) myosin, heavy chain 1, skeletal muscle, adult
dog(100135061) myosin, heavy chain 1, skeletal muscle, adult
cow(281337) myosin, heavy chain 1, skeletal muscle, adult
domestic cat(101084401) myosin, heavy chain 1, skeletal muscle, adult
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104768 Anti-MYH1, (N-terminal) antibody produced in rabbit affinity isolated antibody sheep, rabbit, mouse, guinea pig, rat, human, horse
western blot pricing
M1570 Anti-Myosin (Skeletal, Fast) antibody, Mouse monoclonal clone MY-32, purified from hybridoma cell culture feline, rat, bovine, chicken, human, rabbit, mouse, guinea pig
immunohistochemistry, microarray, western blot pricing
M4276 Monoclonal Anti-Myosin (Skeletal, Fast) antibody produced in mouse clone MY-32, ascites fluid feline, rat, bovine, chicken, human, rabbit, mouse, guinea pig
immunofluorescence, immunohistochemistry, western blot pricing
A4335 Monoclonal Anti-Myosin (Skeletal, Fast)−Alkaline Phosphatase antibody produced in mouse clone MY-32, purified from hybridoma cell culture feline, rat, bovine, chicken, human, rabbit, mouse, guinea pig
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005963 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU186201 MISSION® esiRNA esiRNA targeting mouse Myh1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005963 Rosetta Predictions human pricing
XM_001077982 Rosetta Predictions rat pricing
XM_001078018 Rosetta Predictions rat pricing
XM_213345 Rosetta Predictions rat pricing
NM_030679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208373 predicted 930
2 SASI_Hs02_00340633 predicted 1386
3 SASI_Hs01_00208375 predicted 3423
4 SASI_Hs02_00340634 predicted 1098
5 SASI_Hs01_00208376 predicted 2303
6 SASI_Hs01_00208377 predicted 604
7 SASI_Hs02_00340635 predicted 216
8 SASI_Hs01_00208379 predicted 3943
9 SASI_Hs01_00208380 predicted 4499
10 SASI_Hs01_00208381 predicted 4657
11 SASI_Hs01_00208374 predicted 1182
12 SASI_Hs01_00208378 predicted 2271
13 SASI_Hs01_00208382 predicted 4392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359202 predicted 4847
2 SASI_Rn02_00359203 predicted 5527
3 SASI_Rn02_00359204 predicted 3804
4 SASI_Rn02_00359205 predicted 2369
5 SASI_Rn02_00359206 predicted 2445
6 SASI_Rn02_00359207 predicted 1105
7 SASI_Rn02_00359208 predicted 5559
8 SASI_Rn02_00359209 predicted 5596
9 SASI_Rn02_00359210 predicted 5637
10 SASI_Rn02_00359211 predicted 5568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359385 predicted 4938
2 SASI_Rn02_00359386 predicted 5613
3 SASI_Rn02_00359387 predicted 4552
4 SASI_Rn02_00359388 predicted 2266
5 SASI_Rn02_00359389 predicted 3810
6 SASI_Rn02_00359390 predicted 2368
7 SASI_Rn02_00359391 predicted 4854
8 SASI_Rn02_00359392 predicted 2453
9 SASI_Rn02_00359393 predicted 1105
10 SASI_Rn02_00359394 predicted 5654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191205 predicted 5119
2 SASI_Rn01_00191206 predicted 1949
3 SASI_Rn01_00191207 predicted 5804
4 SASI_Rn01_00191208 predicted 2451
5 SASI_Rn01_00191209 predicted 3994
6 SASI_Rn01_00191210 predicted 2560
7 SASI_Rn01_00191211 predicted 2633
8 SASI_Rn01_00191212 predicted 1298
9 SASI_Rn01_00191213 predicted 5840
10 SASI_Rn01_00191214 predicted 5871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033963 predicted 5602
2 SASI_Mm01_00033964 predicted 3796
3 SASI_Mm01_00033965 predicted 5669
4 SASI_Mm01_00033967 predicted 5641
5 SASI_Mm01_00033968 predicted 1094
6 SASI_Mm01_00033969 predicted 5607
7 SASI_Mm01_00033970 predicted 2058
8 SASI_Mm01_00033971 predicted 2063
9 SASI_Mm01_00033972 predicted 837
10 SASI_Mm02_00336824 predicted 5639
11 SASI_Mm01_00033966 predicted 2055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030679
MYH1 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 1, skeletal muscle, adult
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-2068s1c1
Sequence:CCGGCTGAATAAGCTAATGACCAATCTCGAGATTGGTCATTAGCTTATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-1085s1c1
Sequence:CCGGCCACAGATAGTGCCATTGATACTCGAGTATCAATGGCACTATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-3816s1c1
Sequence:CCGGCATCTCCAAATCTAAGGGAAACTCGAGTTTCCCTTAGATTTGGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-2251s1c1
Sequence:CCGGGCAGACTTCAAGCAGAGATATCTCGAGATATCTCTGCTTGAAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030679
MYH1 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 1, skeletal muscle, adult
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-2068s1c1
Sequence:CCGGCTGAATAAGCTAATGACCAATCTCGAGATTGGTCATTAGCTTATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-1085s1c1
Sequence:CCGGCCACAGATAGTGCCATTGATACTCGAGTATCAATGGCACTATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-3816s1c1
Sequence:CCGGCATCTCCAAATCTAAGGGAAACTCGAGTTTCCCTTAGATTTGGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-2251s1c1
Sequence:CCGGGCAGACTTCAAGCAGAGATATCTCGAGATATCTCTGCTTGAAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030679
MYH1 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 1, skeletal muscle, adult
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-2068s1c1
Sequence:CCGGCTGAATAAGCTAATGACCAATCTCGAGATTGGTCATTAGCTTATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-1085s1c1
Sequence:CCGGCCACAGATAGTGCCATTGATACTCGAGTATCAATGGCACTATCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-3816s1c1
Sequence:CCGGCATCTCCAAATCTAAGGGAAACTCGAGTTTCCCTTAGATTTGGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030679.1-2251s1c1
Sequence:CCGGGCAGACTTCAAGCAGAGATATCTCGAGATATCTCTGCTTGAAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005963
MYH1 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 1, skeletal muscle, adult
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-1905s1c1
Sequence:CCGGCGGTGGAAAGAAAGGTGGTAACTCGAGTTACCACCTTTCTTTCCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-5625s1c1
Sequence:CCGGGCAAGCAAAGGTGAAATCCTACTCGAGTAGGATTTCACCTTTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-3852s1c1
Sequence:CCGGGCAAACAGAATCAGGTGAATACTCGAGTATTCACCTGATTCTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-4480s1c1
Sequence:CCGGGAATCTTTAGACCAACTTGAACTCGAGTTCAAGTTGGTCTAAAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-4489s1c1
Sequence:CCGGGACCAACTTGAAACCTTGAAACTCGAGTTTCAAGGTTTCAAGTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-2560s1c1
Sequence:CCGGGCCAACATGAAGGAAGAATTTCTCGAGAAATTCTTCCTTCATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-5353s1c1
Sequence:CCGGCGGATGAAGAAGAACTTGGAACTCGAGTTCCAAGTTCTTCTTCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-2493s1c1
Sequence:CCGGGCCCTGGATGAAGCTGTATTTCTCGAGAAATACAGCTTCATCCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005963
MYH1 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 1, skeletal muscle, adult
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-1905s1c1
Sequence:CCGGCGGTGGAAAGAAAGGTGGTAACTCGAGTTACCACCTTTCTTTCCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-5625s1c1
Sequence:CCGGGCAAGCAAAGGTGAAATCCTACTCGAGTAGGATTTCACCTTTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-3852s1c1
Sequence:CCGGGCAAACAGAATCAGGTGAATACTCGAGTATTCACCTGATTCTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-4480s1c1
Sequence:CCGGGAATCTTTAGACCAACTTGAACTCGAGTTCAAGTTGGTCTAAAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-4489s1c1
Sequence:CCGGGACCAACTTGAAACCTTGAAACTCGAGTTTCAAGGTTTCAAGTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-2560s1c1
Sequence:CCGGGCCAACATGAAGGAAGAATTTCTCGAGAAATTCTTCCTTCATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-5353s1c1
Sequence:CCGGCGGATGAAGAAGAACTTGGAACTCGAGTTCCAAGTTCTTCTTCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-2493s1c1
Sequence:CCGGGCCCTGGATGAAGCTGTATTTCTCGAGAAATACAGCTTCATCCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005963
MYH1 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 1, skeletal muscle, adult
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-1905s1c1
Sequence:CCGGCGGTGGAAAGAAAGGTGGTAACTCGAGTTACCACCTTTCTTTCCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-5625s1c1
Sequence:CCGGGCAAGCAAAGGTGAAATCCTACTCGAGTAGGATTTCACCTTTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-3852s1c1
Sequence:CCGGGCAAACAGAATCAGGTGAATACTCGAGTATTCACCTGATTCTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-4480s1c1
Sequence:CCGGGAATCTTTAGACCAACTTGAACTCGAGTTCAAGTTGGTCTAAAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-4489s1c1
Sequence:CCGGGACCAACTTGAAACCTTGAAACTCGAGTTTCAAGGTTTCAAGTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005963.2-2560s1c1
Sequence:CCGGGCCAACATGAAGGAAGAATTTCTCGAGAAATTCTTCCTTCATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-5353s1c1
Sequence:CCGGCGGATGAAGAAGAACTTGGAACTCGAGTTCCAAGTTCTTCTTCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005963.2-2493s1c1
Sequence:CCGGGCCCTGGATGAAGCTGTATTTCTCGAGAAATACAGCTTCATCCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)