EMAIL THIS PAGE TO A FRIEND

MYH3

myosin, heavy chain 3, skeletal muscle, embryonic

72 Gene Product Result for
Synonyms: HEMHC MYHC-EMB MYHSE1 SMHCE
UniProtKB ID: P11055, Q15492
Gene ID:
Human(4621) Summary: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. Mutations in this gene have been associated with two congenital contracture (arthrogryposis) syndromes, Freeman-Sheldon syndrome and Sheldon-Hall syndrome. [provided by RefSeq, Jul 2008]
Mouse(17883) myosin, heavy polypeptide 3, skeletal muscle, embryonic
Rat(24583) myosin, heavy chain 3, skeletal muscle, embryonic
sheep(101113252) myosin, heavy chain 3, skeletal muscle, embryonic
naked mole-rat(101698672) myosin, heavy chain 3, skeletal muscle, embryonic
Domestic Rabbit(100009406) myosin, heavy chain 3, skeletal muscle, embryonic
domestic guinea pig(100727290) myosin, heavy chain 3, skeletal muscle, embryonic
cow(281338) myosin, heavy chain 3, skeletal muscle, embryonic
dog(489504) myosin, heavy chain 3, skeletal muscle, embryonic
Horse(100063003) myosin, heavy chain 3, skeletal muscle, embryonic
domestic cat(101084662) myosin, heavy chain 3, skeletal muscle, embryonic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU082001 MISSION® esiRNA esiRNA targeting mouse Myh3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002470 Rosetta Predictions human pricing
NM_012604 Rosetta Predictions rat pricing
NM_001099635 Rosetta Predictions mouse pricing
XM_354614 Rosetta Predictions mouse pricing
XM_908146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075862 predicted 2041
2 SASI_Hs01_00075864 predicted 1436
3 SASI_Hs01_00075865 predicted 4766
4 SASI_Hs01_00075866 predicted 2062
5 SASI_Hs01_00075868 predicted 5678
6 SASI_Hs02_00333892 predicted 2339
7 SASI_Hs01_00075869 predicted 625
8 SASI_Hs01_00075870 predicted 4586
9 SASI_Hs01_00075871 predicted 4565
10 SASI_Hs02_00333893 predicted 3263
11 SASI_Hs01_00075863 predicted 3997
12 SASI_Hs01_00075867 predicted 3401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259773 predicted 1294
2 SASI_Rn01_00051308 predicted 5625
3 SASI_Rn01_00051309 predicted 4599
4 SASI_Rn02_00259774 predicted 3047
5 SASI_Rn01_00051310 predicted 4607
6 SASI_Rn01_00051311 predicted 1015
7 SASI_Rn02_00259775 predicted 1742
8 SASI_Rn01_00051312 predicted 3840
9 SASI_Rn01_00051313 predicted 2305
10 SASI_Rn02_00259776 predicted 1125
11 SASI_Rn01_00051314 predicted 2096
12 SASI_Rn01_00051315 predicted 4641
13 SASI_Rn01_00051316 predicted 4576
14 SASI_Rn01_00051317 predicted 2101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301895 predicted 4585
2 SASI_Mm02_00301896 predicted 2275
3 SASI_Mm02_00301897 predicted 1076
4 SASI_Mm02_00301898 predicted 5649
5 SASI_Mm02_00301899 predicted 2253
6 SASI_Mm02_00301900 predicted 4706
7 SASI_Mm02_00301901 predicted 3004
8 SASI_Mm02_00301902 predicted 1934
9 SASI_Mm02_00301903 predicted 4731
10 SASI_Mm02_00301904 predicted 4550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262852 predicted 4636
2 SASI_Mm01_00262853 predicted 2322
3 SASI_Mm01_00262854 predicted 1124
4 SASI_Mm01_00262855 predicted 5691
5 SASI_Mm01_00262856 predicted 2301
6 SASI_Mm01_00262857 predicted 4759
7 SASI_Mm01_00262858 predicted 1981
8 SASI_Mm01_00262859 predicted 1247
9 SASI_Mm01_00262860 predicted 4607
10 SASI_Mm01_00262861 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433807 predicted 4580
2 SASI_Mm02_00433808 predicted 2275
3 SASI_Mm02_00433809 predicted 1081
4 SASI_Mm02_00433810 predicted 5642
5 SASI_Mm02_00433811 predicted 2257
6 SASI_Mm02_00433812 predicted 4711
7 SASI_Mm02_00433813 predicted 3004
8 SASI_Mm02_00433814 predicted 1937
9 SASI_Mm02_00433815 predicted 4729
10 SASI_Mm02_00433816 predicted 4554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002470
MYH3 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 3, skeletal muscle, embryonic
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1006s1c1
Sequence:CCGGCCTTACGACTACCCGTTCATTCTCGAGAATGAACGGGTAGTCGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4555s1c1
Sequence:CCGGGAAGCCTTAGATCAACTTGAACTCGAGTTCAAGTTGATCTAAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-2097s1c1
Sequence:CCGGGCGTTGTATAATTCCCAATGACTCGAGTCATTGGGAATTATACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1007s1c1
Sequence:CCGGCTTACGACTACCCGTTCATTACTCGAGTAATGAACGGGTAGTCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-3267s1c1
Sequence:CCGGGCTTGCTCAAGAGTCCATATTCTCGAGAATATGGACTCTTGAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-5700s1c1
Sequence:CCGGGCAAGTGAAAGTCAAGTCCTACTCGAGTAGGACTTGACTTTCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4363s1c1
Sequence:CCGGGAGGATCTGATGGTTGATGTTCTCGAGAACATCAACCATCAGATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1291s1c1
Sequence:CCGGCCTAGAGTGAAAGTTGGGAATCTCGAGATTCCCAACTTTCACTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4950s1c1
Sequence:CCGGCCTGAATGAAATCGAGATCCACTCGAGTGGATCTCGATTTCATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-2529s1c1
Sequence:CCGGCCAGTACAACATTCGCTCATTCTCGAGAATGAGCGAATGTTGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002470
MYH3 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 3, skeletal muscle, embryonic
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1006s1c1
Sequence:CCGGCCTTACGACTACCCGTTCATTCTCGAGAATGAACGGGTAGTCGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4555s1c1
Sequence:CCGGGAAGCCTTAGATCAACTTGAACTCGAGTTCAAGTTGATCTAAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-2097s1c1
Sequence:CCGGGCGTTGTATAATTCCCAATGACTCGAGTCATTGGGAATTATACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1007s1c1
Sequence:CCGGCTTACGACTACCCGTTCATTACTCGAGTAATGAACGGGTAGTCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-3267s1c1
Sequence:CCGGGCTTGCTCAAGAGTCCATATTCTCGAGAATATGGACTCTTGAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-5700s1c1
Sequence:CCGGGCAAGTGAAAGTCAAGTCCTACTCGAGTAGGACTTGACTTTCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4363s1c1
Sequence:CCGGGAGGATCTGATGGTTGATGTTCTCGAGAACATCAACCATCAGATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1291s1c1
Sequence:CCGGCCTAGAGTGAAAGTTGGGAATCTCGAGATTCCCAACTTTCACTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4950s1c1
Sequence:CCGGCCTGAATGAAATCGAGATCCACTCGAGTGGATCTCGATTTCATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-2529s1c1
Sequence:CCGGCCAGTACAACATTCGCTCATTCTCGAGAATGAGCGAATGTTGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002470
MYH3 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 3, skeletal muscle, embryonic
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1006s1c1
Sequence:CCGGCCTTACGACTACCCGTTCATTCTCGAGAATGAACGGGTAGTCGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4555s1c1
Sequence:CCGGGAAGCCTTAGATCAACTTGAACTCGAGTTCAAGTTGATCTAAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-2097s1c1
Sequence:CCGGGCGTTGTATAATTCCCAATGACTCGAGTCATTGGGAATTATACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1007s1c1
Sequence:CCGGCTTACGACTACCCGTTCATTACTCGAGTAATGAACGGGTAGTCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-3267s1c1
Sequence:CCGGGCTTGCTCAAGAGTCCATATTCTCGAGAATATGGACTCTTGAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-5700s1c1
Sequence:CCGGGCAAGTGAAAGTCAAGTCCTACTCGAGTAGGACTTGACTTTCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4363s1c1
Sequence:CCGGGAGGATCTGATGGTTGATGTTCTCGAGAACATCAACCATCAGATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-1291s1c1
Sequence:CCGGCCTAGAGTGAAAGTTGGGAATCTCGAGATTCCCAACTTTCACTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-4950s1c1
Sequence:CCGGCCTGAATGAAATCGAGATCCACTCGAGTGGATCTCGATTTCATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002470.1-2529s1c1
Sequence:CCGGCCAGTACAACATTCGCTCATTCTCGAGAATGAGCGAATGTTGTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099635
MYH3 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 3, skeletal muscle, embryonic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-688s21c1
Sequence:CCGGGGACGCTGGAGGATCAAATTACTCGAGTAATTTGATCCTCCAGCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-3228s21c1
Sequence:CCGGCTTGCCCAAGAGTCCATATTACTCGAGTAATATGGACTCTTGGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-1358s21c1
Sequence:CCGGGTGGATGGTCACTCGTATTAACTCGAGTTAATACGAGTGACCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-2014s21c1
Sequence:CCGGACAAGCTGATGTCCAATTTAACTCGAGTTAAATTGGACATCAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-5570s21c1
Sequence:CCGGGAAGTATGAGCGGCGTGTTAACTCGAGTTAACACGCCGCTCATACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099635
MYH3 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 3, skeletal muscle, embryonic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-688s21c1
Sequence:CCGGGGACGCTGGAGGATCAAATTACTCGAGTAATTTGATCCTCCAGCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-3228s21c1
Sequence:CCGGCTTGCCCAAGAGTCCATATTACTCGAGTAATATGGACTCTTGGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-1358s21c1
Sequence:CCGGGTGGATGGTCACTCGTATTAACTCGAGTTAATACGAGTGACCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-2014s21c1
Sequence:CCGGACAAGCTGATGTCCAATTTAACTCGAGTTAAATTGGACATCAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-5570s21c1
Sequence:CCGGGAAGTATGAGCGGCGTGTTAACTCGAGTTAACACGCCGCTCATACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099635
MYH3 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 3, skeletal muscle, embryonic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-688s21c1
Sequence:CCGGGGACGCTGGAGGATCAAATTACTCGAGTAATTTGATCCTCCAGCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-3228s21c1
Sequence:CCGGCTTGCCCAAGAGTCCATATTACTCGAGTAATATGGACTCTTGGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-1358s21c1
Sequence:CCGGGTGGATGGTCACTCGTATTAACTCGAGTTAATACGAGTGACCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-2014s21c1
Sequence:CCGGACAAGCTGATGTCCAATTTAACTCGAGTTAAATTGGACATCAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099635.1-5570s21c1
Sequence:CCGGGAAGTATGAGCGGCGTGTTAACTCGAGTTAACACGCCGCTCATACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)