EMAIL THIS PAGE TO A FRIEND

MYH6

myosin, heavy chain 6, cardiac muscle, alpha

106 Gene Product Result for
Synonyms: ASD3 CMD1EE CMH14 MYHC MYHCA SSS3 alpha-MHC
UniProtKB ID: P13533, A2RTX1, Q13943, Q14906, Q14907
Gene ID:
Human(4624) Summary: Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Mar 2010]
Mouse(17888) myosin, heavy polypeptide 6, cardiac muscle, alpha
Rat(29556) myosin, heavy chain 6, cardiac muscle, alpha
sheep(101120580) myosin, heavy chain 6, cardiac muscle, alpha
naked mole-rat(101707554) myosin, heavy chain 6, cardiac muscle, alpha
Domestic Rabbit(100125987) myosin, heavy chain 6, cardiac muscle, alpha
domestic guinea pig(100727418) myosin, heavy chain 6, cardiac muscle, alpha
Zebrafish(386711) myosin, heavy polypeptide 6, cardiac muscle, alpha
cow(100296004) myosin, heavy chain 6, cardiac muscle, alpha
Horse(100034088) myosin, heavy chain 6, cardiac muscle, alpha
domestic cat(101095986) myosin, heavy chain 6, cardiac muscle, alpha
dog(100685644) myosin, heavy chain 6, cardiac muscle, alpha
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
AXIO0017 Cor.At CL Cardiomyocytes (Mouse ES cell derived) 0.5M mouse pricing
AXIO0024 Cor.At CL Cardiomyocytes (Mouse ES cell derived) 1000M mouse pricing
AXIO0018 Cor.At CL Cardiomyocytes (Mouse ES cell derived) 1M mouse pricing
AXIO0023 Cor.At CL Cardiomyocytes (Mouse ES cell derived) 500M mouse pricing
AXIO0022 Cor.At CL Cardiomyocytes (Mouse ES cell derived) 5M mouse pricing
AXIO0021 Cor.At CL xCELLigence Cardio (Mouse ES Cell Derived) 4M mouse pricing
AXIO0067 Cor.At CL-HYPERTROPHY KIT mouse pricing
AXIO0001 Cor.At CL-i Cardiomyocytes (Mouse iPS cell derived) 0.5M mouse pricing
AXIO0008 Cor.At CL-i Cardiomyocytes (Mouse iPS cell derived) 1000M mouse pricing
AXIO0005 Cor.At CL-i Cardiomyocytes (Mouse iPS cell derived) 4M mouse pricing
AXIO0007 Cor.At CL-i Cardiomyocytes (Mouse iPS cell derived) 500M mouse pricing
AXIO0057 Cor.At CL-i-HYPERTROPHY KIT mouse pricing
AXIO0056 Cor.At CL-i-MitoTox Kit mouse pricing
AXIO0054 Cor.At CL-i-Starter Kit mouse pricing
AXIO0055 Cor.At CL-i-Tox Kit mouse pricing
AXIO0060 Cor.At CL-i-Tox Kit mouse pricing
AXIO0058 Cor.At CL-i-xCELLigence Cardio Kit mouse pricing
AXIO0066 Cor.At CL-MitoTox Kit mouse pricing
AXIO0064 Cor.At CL-Starter Kit mouse pricing
AXIO0068 Cor.At CL-xCELLigence Cardio Kit mouse pricing
AXIO0025 Cor.At GFP Cardiomyocytes (Mouse ES cell derived) 0.5M mouse pricing
AXIO0032 Cor.At GFP Cardiomyocytes (Mouse ES cell derived) 1000M mouse pricing
AXIO0026 Cor.At GFP Cardiomyocytes (Mouse ES cell derived) 1M mouse pricing
AXIO0031 Cor.At GFP Cardiomyocytes (Mouse ES cell derived) 500M mouse pricing
AXIO0030 Cor.At GFP Cardiomyocytes (Mouse ES cell derived) 5M mouse pricing
AXIO0029 Cor.At GFP xCELLigence Cardio (Mouse ES Cell Derived) 4M mouse pricing
AXIO0072 Cor.At GFP-HYPERTROPHY KIT mouse pricing
AXIO0016 Cor.At GFP-i Cardiomyocytes (Mouse iPS cell derived) 1000M mouse pricing
AXIO0015 Cor.At GFP-i Cardiomyocytes (Mouse iPS cell derived) 500M mouse pricing
AXIO0062 Cor.At GFP-i-HYPERTROPHY KIT mouse pricing
AXIO0061 Cor.At GFP-i-MitoTox Kit mouse pricing
AXIO0059 Cor.At GFP-i-Starter Kit mouse pricing
AXIO0063 Cor.At GFP-i-xCELLigence Cardio Kit mouse pricing
AXIO0071 Cor.At GFP-MitoTox Kit mouse pricing
AXIO0069 Cor.At GFP-Starter Kit mouse pricing
AXIO0070 Cor.At GFP-Tox Kit mouse pricing
AXIO0073 Cor.At GFP-xCELLigence Cardio Kit mouse pricing
AXIO0002 Cor.At CL-i Cardiomyocytes (Mouse iPS cell derived) 1M pricing
AXIO0044 Cor.At CL-i Cardiomyocytes (Mouse iPS cell derived) 1M Kit with Puromycin and Medium pricing
AXIO0006 Cor.At CL-i Cardiomyocytes (Mouse iPS cell derived) 5M pricing
AXIO0045 Cor.At CL-i Cardiomyocytes (Mouse iPS cell derived) 5M Kit with Puromycin and Medium pricing
AXIO0010 Cor.At GFP-i Cardiomyocytes (Mouse iPS cell derived) 1M pricing
AXIO0046 Cor.At GFP-i Cardiomyocytes (Mouse iPS cell derived) 1M Kit with Puromycin and Medium pricing
AXIO0014 Cor.At GFP-i Cardiomyocytes (Mouse iPS cell derived) 5M pricing
AXIO0047 Cor.At GFP-i Cardiomyocytes (Mouse iPS cell derived) 5M Kit with Puromycin and Medium pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0236 AQUA Peptide NAYEESLEHLETF[K] African clawed frog, chicken, cow, dog, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002471 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002471 Rosetta Predictions human pricing
NM_017239 Rosetta Predictions rat pricing
NM_010856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333894 predicted 2860
2 SASI_Hs01_00232858 predicted 4622
3 SASI_Hs01_00232860 predicted 1873
4 SASI_Hs02_00333895 predicted 3981
5 SASI_Hs01_00232861 predicted 238
6 SASI_Hs01_00232862 predicted 3306
7 SASI_Hs01_00232863 predicted 2457
8 SASI_Hs02_00333896 predicted 978
9 SASI_Hs02_00333897 predicted 305
10 SASI_Hs02_00333898 predicted 2814
11 SASI_Hs01_00232855 predicted 1277
12 SASI_Hs01_00232856 predicted 4192
13 SASI_Hs01_00232857 predicted 5615
14 SASI_Hs01_00232859 predicted 1588
15 SASI_Hs01_00232864 predicted 1590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105337 predicted 1670
2 SASI_Rn01_00105338 predicted 1280
3 SASI_Rn02_00261608 predicted 5574
4 SASI_Rn01_00105339 predicted 2943
5 SASI_Rn01_00105340 predicted 765
6 SASI_Rn02_00261609 predicted 1322
7 SASI_Rn02_00261610 predicted 1023
8 SASI_Rn01_00105341 predicted 4008
9 SASI_Rn01_00105342 predicted 2473
10 SASI_Rn01_00105344 predicted 2613
11 SASI_Rn01_00105343 predicted 1099
12 SASI_Rn01_00105345 predicted 2299
13 SASI_Rn01_00105346 predicted 5673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129337 predicted 848
2 SASI_Mm01_00129338 predicted 1613
3 SASI_Mm01_00129339 predicted 298
4 SASI_Mm01_00129342 predicted 1159
5 SASI_Mm02_00319509 predicted 2493
6 SASI_Mm02_00319510 predicted 1954
7 SASI_Mm02_00319511 predicted 1960
8 SASI_Mm02_00319512 predicted 1343
9 SASI_Mm02_00319513 predicted 4104
10 SASI_Mm02_00319514 predicted 927
11 SASI_Mm01_00129340 predicted 3015
12 SASI_Mm01_00129341 predicted 5649
13 SASI_Mm01_00129343 predicted 3999
14 SASI_Mm01_00129344 predicted 4930
15 SASI_Mm01_00129345 predicted 1403
16 SASI_Mm01_00129346 predicted 4204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002471
MYH6 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 6, cardiac muscle, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-3989s1c1
Sequence:CCGGGCTCTCTTATACCCAGCAAATCTCGAGATTTGCTGGGTATAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-317s1c1
Sequence:CCGGGTTCGACAAGATTCAGGACATCTCGAGATGTCCTGAATCTTGTCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-905s1c1
Sequence:CCGGAGCTGAGAGAAACTACCACATCTCGAGATGTGGTAGTTTCTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-2472s1c1
Sequence:CCGGGAGTTCAAGAAGATAGTGGAACTCGAGTTCCACTATCTTCTTGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-3131s1c1
Sequence:CCGGCCTGTCCAAGTCTAAGGTCAACTCGAGTTGACCTTAGACTTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-1740s21c1
Sequence:CCGGCACCTGGGCAAGTCCAACAATCTCGAGATTGTTGGACTTGCCCAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-692s21c1
Sequence:CCGGGGACAATGCCAATGCGAACAACTCGAGTTGTTCGCATTGGCATTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-239s21c1
Sequence:CCGGAGGCAAGGTCATTGCTGAAACCTCGAGGTTTCAGCAATGACCTTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-4595s21c1
Sequence:CCGGGGAGGAAATCTCGGACCTTACCTCGAGGTAAGGTCCGAGATTTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-1941s21c1
Sequence:CCGGTCCTACGCAACTGCCGATACTCTCGAGAGTATCGGCAGTTGCGTAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002471
MYH6 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 6, cardiac muscle, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-3989s1c1
Sequence:CCGGGCTCTCTTATACCCAGCAAATCTCGAGATTTGCTGGGTATAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-317s1c1
Sequence:CCGGGTTCGACAAGATTCAGGACATCTCGAGATGTCCTGAATCTTGTCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-905s1c1
Sequence:CCGGAGCTGAGAGAAACTACCACATCTCGAGATGTGGTAGTTTCTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-2472s1c1
Sequence:CCGGGAGTTCAAGAAGATAGTGGAACTCGAGTTCCACTATCTTCTTGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-3131s1c1
Sequence:CCGGCCTGTCCAAGTCTAAGGTCAACTCGAGTTGACCTTAGACTTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-1740s21c1
Sequence:CCGGCACCTGGGCAAGTCCAACAATCTCGAGATTGTTGGACTTGCCCAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-692s21c1
Sequence:CCGGGGACAATGCCAATGCGAACAACTCGAGTTGTTCGCATTGGCATTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-239s21c1
Sequence:CCGGAGGCAAGGTCATTGCTGAAACCTCGAGGTTTCAGCAATGACCTTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-4595s21c1
Sequence:CCGGGGAGGAAATCTCGGACCTTACCTCGAGGTAAGGTCCGAGATTTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-1941s21c1
Sequence:CCGGTCCTACGCAACTGCCGATACTCTCGAGAGTATCGGCAGTTGCGTAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002471
MYH6 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 6, cardiac muscle, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-3989s1c1
Sequence:CCGGGCTCTCTTATACCCAGCAAATCTCGAGATTTGCTGGGTATAAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-317s1c1
Sequence:CCGGGTTCGACAAGATTCAGGACATCTCGAGATGTCCTGAATCTTGTCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-905s1c1
Sequence:CCGGAGCTGAGAGAAACTACCACATCTCGAGATGTGGTAGTTTCTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-2472s1c1
Sequence:CCGGGAGTTCAAGAAGATAGTGGAACTCGAGTTCCACTATCTTCTTGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002471.1-3131s1c1
Sequence:CCGGCCTGTCCAAGTCTAAGGTCAACTCGAGTTGACCTTAGACTTGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-1740s21c1
Sequence:CCGGCACCTGGGCAAGTCCAACAATCTCGAGATTGTTGGACTTGCCCAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-692s21c1
Sequence:CCGGGGACAATGCCAATGCGAACAACTCGAGTTGTTCGCATTGGCATTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-239s21c1
Sequence:CCGGAGGCAAGGTCATTGCTGAAACCTCGAGGTTTCAGCAATGACCTTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-4595s21c1
Sequence:CCGGGGAGGAAATCTCGGACCTTACCTCGAGGTAAGGTCCGAGATTTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002471.3-1941s21c1
Sequence:CCGGTCCTACGCAACTGCCGATACTCTCGAGAGTATCGGCAGTTGCGTAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010856
MYH6 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 6, cardiac muscle, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-3060s1c1
Sequence:CCGGGCTGGATGAAATCATTGCCAACTCGAGTTGGCAATGATTTCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-3165s1c1
Sequence:CCGGGCTGACCAAGTCCAAAGTCAACTCGAGTTGACTTTGGACTTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-2500s1c1
Sequence:CCGGCGCATTGAGTTCAAGAAGATACTCGAGTATCTTCTTGAACTCAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-1957s1c1
Sequence:CCGGGCTACACTCTTCTCTACCTATCTCGAGATAGGTAGAGAAGAGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-2785s1c1
Sequence:CCGGGCGGAACAAGACAACCTCAATCTCGAGATTGAGGTTGTCTTGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010856
MYH6 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 6, cardiac muscle, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-3060s1c1
Sequence:CCGGGCTGGATGAAATCATTGCCAACTCGAGTTGGCAATGATTTCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-3165s1c1
Sequence:CCGGGCTGACCAAGTCCAAAGTCAACTCGAGTTGACTTTGGACTTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-2500s1c1
Sequence:CCGGCGCATTGAGTTCAAGAAGATACTCGAGTATCTTCTTGAACTCAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-1957s1c1
Sequence:CCGGGCTACACTCTTCTCTACCTATCTCGAGATAGGTAGAGAAGAGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-2785s1c1
Sequence:CCGGGCGGAACAAGACAACCTCAATCTCGAGATTGAGGTTGTCTTGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010856
MYH6 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 6, cardiac muscle, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-3060s1c1
Sequence:CCGGGCTGGATGAAATCATTGCCAACTCGAGTTGGCAATGATTTCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-3165s1c1
Sequence:CCGGGCTGACCAAGTCCAAAGTCAACTCGAGTTGACTTTGGACTTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-2500s1c1
Sequence:CCGGCGCATTGAGTTCAAGAAGATACTCGAGTATCTTCTTGAACTCAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-1957s1c1
Sequence:CCGGGCTACACTCTTCTCTACCTATCTCGAGATAGGTAGAGAAGAGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010856.2-2785s1c1
Sequence:CCGGGCGGAACAAGACAACCTCAATCTCGAGATTGAGGTTGTCTTGTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)