EMAIL THIS PAGE TO A FRIEND

MYH7

myosin, heavy chain 7, cardiac muscle, beta

72 Gene Product Result for
Synonyms: CMD1S CMH1 MPD1 MYHCB SPMD SPMM
Gene ID:
Human(4625) Summary: Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Mouse(140781) myosin, heavy polypeptide 7, cardiac muscle, beta
Rat(29557) myosin, heavy chain 7, cardiac muscle, beta
Zebrafish(100534858) myosin, heavy chain 7, cardiac muscle, beta
chicken(395350) myosin, heavy chain 7, cardiac muscle, beta
dog(403807) myosin, heavy chain 7, cardiac muscle, beta
Horse(791234) myosin, heavy chain 7, cardiac muscle, beta
cow(282714) myosin, heavy chain 7, cardiac muscle, beta
domestic cat(101096736) myosin, heavy chain 7, cardiac muscle, beta
domestic guinea pig(100727138) myosin, heavy chain 7, cardiac muscle, beta
Domestic Rabbit(100101566) myosin, heavy chain 7, cardiac muscle, beta
naked mole-rat(101707190) myosin, heavy chain 7, cardiac muscle, beta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001349 Anti-MYH6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA001239 Anti-MYH7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106550 Anti-MYH7 antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, human, horse
immunohistochemistry, western blot pricing
M8421 Monoclonal Anti-Myosin (Skeletal, Slow) antibody produced in mouse clone NOQ7.5.4D, ascites fluid sheep, hamster, goat, rabbit, human, canine, bovine, rat, feline, pig, guinea pig, mouse, chicken
electron microscopy, ELISA, immunohistochemistry, radioimmunoassay, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0236 AQUA Peptide NAYEESLEHLETF[K] African clawed frog, chicken, cow, dog, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000257 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000257 Rosetta Predictions human pricing
NM_017240 Rosetta Predictions rat pricing
NM_080728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302187 predicted 2107
2 SASI_Hs02_00302188 predicted 837
3 SASI_Hs01_00210443 predicted 677
4 SASI_Hs01_00210445 predicted 2011
5 SASI_Hs02_00302189 predicted 838
6 SASI_Hs02_00302190 predicted 1769
7 SASI_Hs01_00210448 predicted 2671
8 SASI_Hs02_00302191 predicted 2112
9 SASI_Hs02_00302192 predicted 652
10 SASI_Hs02_00302193 predicted 4694
11 SASI_Hs01_00210439 predicted 4207
12 SASI_Hs01_00210440 predicted 275
13 SASI_Hs01_00210441 predicted 2915
14 SASI_Hs01_00210442 predicted 5627
15 SASI_Hs01_00210444 predicted 1373
16 SASI_Hs01_00210446 predicted 1764
17 SASI_Hs01_00210447 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261611 predicted 5542
2 SASI_Rn01_00052290 predicted 733
3 SASI_Rn01_00052291 predicted 1218
4 SASI_Rn02_00261612 predicted 836
5 SASI_Rn01_00052293 predicted 2439
6 SASI_Rn01_00052294 predicted 2913
7 SASI_Rn01_00052295 predicted 1042
8 SASI_Rn01_00052296 predicted 1532
9 SASI_Rn01_00052297 predicted 1250
10 SASI_Rn01_00052298 predicted 2575
11 SASI_Rn01_00052292 predicted 744
12 SASI_Rn01_00052299 predicted 2276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338200 predicted 963
2 SASI_Mm02_00338201 predicted 1339
3 SASI_Mm02_00338202 predicted 1140
4 SASI_Mm02_00338203 predicted 974
5 SASI_Mm01_00045137 predicted 1991
6 SASI_Mm01_00045139 predicted 2046
7 SASI_Mm01_00045141 predicted 1165
8 SASI_Mm02_00338204 predicted 229
9 SASI_Mm02_00338205 predicted 1303
10 SASI_Mm02_00338206 predicted 870
11 SASI_Mm01_00045134 predicted 1659
12 SASI_Mm01_00045135 predicted 5675
13 SASI_Mm01_00045136 predicted 2934
14 SASI_Mm01_00045138 predicted 1388
15 SASI_Mm01_00045140 predicted 4966
16 SASI_Mm01_00045142 predicted 1435
17 SASI_Mm01_00045143 predicted 3387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000257
MYH7 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 7, cardiac muscle, beta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000257.2-1353s21c1
Sequence:CCGGATGTCCAGCAGGTGATATATGCTCGAGCATATATCACCTGCTGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000257.2-2528s21c1
Sequence:CCGGAGAGACTCCCTGCTGGTAATCCTCGAGGATTACCAGCAGGGAGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-1971s1c1
Sequence:CCGGGCGCCTATTGAGAAGGGCAAACTCGAGTTTGCCCTTCTCAATAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-921s1c1
Sequence:CCGGGCAGAGAGAGATTATCACATTCTCGAGAATGTGATAATCTCTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-2093s1c1
Sequence:CCGGTGTACGTTGTATCATCCCTAACTCGAGTTAGGGATGATACAACGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-387s1c1
Sequence:CCGGGTGCTCTACAACCTCAAGGATCTCGAGATCCTTGAGGTTGTAGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-2094s1c1
Sequence:CCGGGTACGTTGTATCATCCCTAATCTCGAGATTAGGGATGATACAACGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000257
MYH7 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 7, cardiac muscle, beta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000257.2-1353s21c1
Sequence:CCGGATGTCCAGCAGGTGATATATGCTCGAGCATATATCACCTGCTGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000257.2-2528s21c1
Sequence:CCGGAGAGACTCCCTGCTGGTAATCCTCGAGGATTACCAGCAGGGAGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-1971s1c1
Sequence:CCGGGCGCCTATTGAGAAGGGCAAACTCGAGTTTGCCCTTCTCAATAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-921s1c1
Sequence:CCGGGCAGAGAGAGATTATCACATTCTCGAGAATGTGATAATCTCTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-2093s1c1
Sequence:CCGGTGTACGTTGTATCATCCCTAACTCGAGTTAGGGATGATACAACGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-387s1c1
Sequence:CCGGGTGCTCTACAACCTCAAGGATCTCGAGATCCTTGAGGTTGTAGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-2094s1c1
Sequence:CCGGGTACGTTGTATCATCCCTAATCTCGAGATTAGGGATGATACAACGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000257
MYH7 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 7, cardiac muscle, beta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000257.2-1353s21c1
Sequence:CCGGATGTCCAGCAGGTGATATATGCTCGAGCATATATCACCTGCTGGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000257.2-2528s21c1
Sequence:CCGGAGAGACTCCCTGCTGGTAATCCTCGAGGATTACCAGCAGGGAGTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-1971s1c1
Sequence:CCGGGCGCCTATTGAGAAGGGCAAACTCGAGTTTGCCCTTCTCAATAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-921s1c1
Sequence:CCGGGCAGAGAGAGATTATCACATTCTCGAGAATGTGATAATCTCTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-2093s1c1
Sequence:CCGGTGTACGTTGTATCATCCCTAACTCGAGTTAGGGATGATACAACGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-387s1c1
Sequence:CCGGGTGCTCTACAACCTCAAGGATCTCGAGATCCTTGAGGTTGTAGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000257.1-2094s1c1
Sequence:CCGGGTACGTTGTATCATCCCTAATCTCGAGATTAGGGATGATACAACGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080728
MYH7 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 7, cardiac muscle, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1168s1c1
Sequence:CCGGCCAGAAGAGAAGAACTCCATTCTCGAGAATGGAGTTCTTCTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1271s1c1
Sequence:CCGGGCACTGAAGAAGCTGACAAATCTCGAGATTTGTCAGCTTCTTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1989s1c1
Sequence:CCGGGCTCAGCAATCTATTTGCCAACTCGAGTTGGCAAATAGATTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-2526s1c1
Sequence:CCGGGCTCTCCAGAATGGAGTTCAACTCGAGTTGAACTCCATTCTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-258s1c1
Sequence:CCGGGCCCGATGACAAAGAAGAGTTCTCGAGAACTCTTCTTTGTCATCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080728
MYH7 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 7, cardiac muscle, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1168s1c1
Sequence:CCGGCCAGAAGAGAAGAACTCCATTCTCGAGAATGGAGTTCTTCTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1271s1c1
Sequence:CCGGGCACTGAAGAAGCTGACAAATCTCGAGATTTGTCAGCTTCTTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1989s1c1
Sequence:CCGGGCTCAGCAATCTATTTGCCAACTCGAGTTGGCAAATAGATTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-2526s1c1
Sequence:CCGGGCTCTCCAGAATGGAGTTCAACTCGAGTTGAACTCCATTCTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-258s1c1
Sequence:CCGGGCCCGATGACAAAGAAGAGTTCTCGAGAACTCTTCTTTGTCATCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080728
MYH7 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 7, cardiac muscle, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1168s1c1
Sequence:CCGGCCAGAAGAGAAGAACTCCATTCTCGAGAATGGAGTTCTTCTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1271s1c1
Sequence:CCGGGCACTGAAGAAGCTGACAAATCTCGAGATTTGTCAGCTTCTTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-1989s1c1
Sequence:CCGGGCTCAGCAATCTATTTGCCAACTCGAGTTGGCAAATAGATTGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-2526s1c1
Sequence:CCGGGCTCTCCAGAATGGAGTTCAACTCGAGTTGAACTCCATTCTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080728.1-258s1c1
Sequence:CCGGGCCCGATGACAAAGAAGAGTTCTCGAGAACTCTTCTTTGTCATCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)