EMAIL THIS PAGE TO A FRIEND

MYH7B

myosin, heavy chain 7B, cardiac muscle, beta

53 Gene Product Result for
Synonyms: MHC14 MYH14
Gene ID:
Human(57644) Summary: The myosin II molecule is a multi-subunit complex consisting of two heavy chains and four light chains. This gene encodes a heavy chain of myosin II, which is a member of the motor-domain superfamily. The heavy chain includes a globular motor domain, which catalyzes ATP hydrolysis and interacts with actin, and a tail domain in which heptad repeat sequences promote dimerization by interacting to form a rod-like alpha-helical coiled coil. This heavy chain subunit is a slow-twitch myosin. Alternatively spliced transcript variants have been found, but the full-length nature of these variants is not determined. [provided by RefSeq, Mar 2010]
Mouse(668940) myosin, heavy chain 7B, cardiac muscle, beta
Rat(311570) myosin, heavy chain 7B, cardiac muscle, beta
sheep(101119327) myosin, heavy chain 7B, cardiac muscle, beta
naked mole-rat(101701118) myosin, heavy chain 7B, cardiac muscle, beta
domestic guinea pig(100731002) myosin, heavy chain 7B, cardiac muscle, beta
Zebrafish(795534) myosin, heavy chain 7b
cow(521764) myosin, heavy chain 7B, cardiac muscle, beta
chicken(395279) myosin, heavy chain 7B, cardiac muscle, beta
domestic cat(101088400) myosin, heavy chain 7B, cardiac muscle, beta
dog(477206) myosin, heavy chain 7B, cardiac muscle, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020884 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139781 MISSION® esiRNA esiRNA human MYH7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020884 Rosetta Predictions human pricing
NM_001107794 Rosetta Predictions rat pricing
NM_001085378 Rosetta Predictions mouse pricing
XR_002269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142701 predicted 2539
2 SASI_Hs01_00142702 predicted 5775
3 SASI_Hs01_00142703 predicted 1527
4 SASI_Hs01_00142704 predicted 2702
5 SASI_Hs01_00142705 predicted 1257
6 SASI_Hs01_00142706 predicted 958
7 SASI_Hs01_00142708 predicted 3982
8 SASI_Hs01_00142709 predicted 609
9 SASI_Hs01_00142710 predicted 1008
10 SASI_Hs02_00354194 predicted 5805
11 SASI_Hs01_00142707 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232335 predicted 879
2 SASI_Rn02_00232336 predicted 1047
3 SASI_Rn02_00232337 predicted 1743
4 SASI_Rn02_00232338 predicted 860
5 SASI_Rn02_00232339 predicted 635
6 SASI_Rn02_00232340 predicted 863
7 SASI_Rn02_00232341 predicted 386
8 SASI_Rn02_00232342 predicted 2288
9 SASI_Rn02_00232343 predicted 554
10 SASI_Rn02_00232344 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300265 predicted 5713
2 SASI_Mm02_00300266 predicted 1854
3 SASI_Mm02_00300267 predicted 2394
4 SASI_Mm02_00300268 predicted 2334
5 SASI_Mm02_00300269 predicted 5808
6 SASI_Mm02_00300270 predicted 1124
7 SASI_Mm02_00300271 predicted 1039
8 SASI_Mm02_00300272 predicted 4884
9 SASI_Mm02_00300273 predicted 2053
10 SASI_Mm02_00300274 predicted 2611
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216858 predicted 2075
2 SASI_Mm01_00216859 predicted 2134
3 SASI_Mm01_00216860 predicted 2681
4 SASI_Mm01_00216861 predicted 2623
5 SASI_Mm01_00216862 predicted 418
6 SASI_Mm01_00216863 predicted 1412
7 SASI_Mm01_00216864 predicted 1326
8 SASI_Mm01_00216865 predicted 5167
9 SASI_Mm01_00216866 predicted 2340
10 SASI_Mm01_00216867 predicted 2890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020884
MYH7B MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 7B, cardiac muscle, beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-1257s1c1
Sequence:CCGGGATGAGAAATGTGCCTGCTATCTCGAGATAGCAGGCACATTTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-2189s1c1
Sequence:CCGGGCACAAGGAGAACCTCAACAACTCGAGTTGTTGAGGTTCTCCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-2711s1c1
Sequence:CCGGCAAGAACTGGTCATGGATGAACTCGAGTTCATCCATGACCAGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-216s1c1
Sequence:CCGGGCCATGATGGATGTGAGTGAACTCGAGTTCACTCACATCCATCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-464s1c1
Sequence:CCGGCTTCGACTTACTGGAGGACATCTCGAGATGTCCTCCAGTAAGTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-1007s1c1
Sequence:CCGGCGCGGATATTGACAGCTATCTCTCGAGAGATAGCTGTCAATATCCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-2708s1c1
Sequence:CCGGCGTCAAGAACTGGTCATGGATCTCGAGATCCATGACCAGTTCTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-771s1c1
Sequence:CCGGGTTAACACCAAGCGGGTCATTCTCGAGAATGACCCGCTTGGTGTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-5855s1c1
Sequence:CCGGGAGCAAGGTCAAGAGCTACAACTCGAGTTGTAGCTCTTGACCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-3164s1c1
Sequence:CCGGGAAGAACCTGACGGAAGAGATCTCGAGATCTCTTCCGTCAGGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-1685s1c1
Sequence:CCGGGCAGTTCTTCAACCAGCACATCTCGAGATGTGCTGGTTGAAGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020884
MYH7B MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 7B, cardiac muscle, beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-1257s1c1
Sequence:CCGGGATGAGAAATGTGCCTGCTATCTCGAGATAGCAGGCACATTTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-2189s1c1
Sequence:CCGGGCACAAGGAGAACCTCAACAACTCGAGTTGTTGAGGTTCTCCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-2711s1c1
Sequence:CCGGCAAGAACTGGTCATGGATGAACTCGAGTTCATCCATGACCAGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-216s1c1
Sequence:CCGGGCCATGATGGATGTGAGTGAACTCGAGTTCACTCACATCCATCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-464s1c1
Sequence:CCGGCTTCGACTTACTGGAGGACATCTCGAGATGTCCTCCAGTAAGTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-1007s1c1
Sequence:CCGGCGCGGATATTGACAGCTATCTCTCGAGAGATAGCTGTCAATATCCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-2708s1c1
Sequence:CCGGCGTCAAGAACTGGTCATGGATCTCGAGATCCATGACCAGTTCTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-771s1c1
Sequence:CCGGGTTAACACCAAGCGGGTCATTCTCGAGAATGACCCGCTTGGTGTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-5855s1c1
Sequence:CCGGGAGCAAGGTCAAGAGCTACAACTCGAGTTGTAGCTCTTGACCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-3164s1c1
Sequence:CCGGGAAGAACCTGACGGAAGAGATCTCGAGATCTCTTCCGTCAGGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-1685s1c1
Sequence:CCGGGCAGTTCTTCAACCAGCACATCTCGAGATGTGCTGGTTGAAGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020884
MYH7B MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 7B, cardiac muscle, beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-1257s1c1
Sequence:CCGGGATGAGAAATGTGCCTGCTATCTCGAGATAGCAGGCACATTTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-2189s1c1
Sequence:CCGGGCACAAGGAGAACCTCAACAACTCGAGTTGTTGAGGTTCTCCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-2711s1c1
Sequence:CCGGCAAGAACTGGTCATGGATGAACTCGAGTTCATCCATGACCAGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-216s1c1
Sequence:CCGGGCCATGATGGATGTGAGTGAACTCGAGTTCACTCACATCCATCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-464s1c1
Sequence:CCGGCTTCGACTTACTGGAGGACATCTCGAGATGTCCTCCAGTAAGTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-1007s1c1
Sequence:CCGGCGCGGATATTGACAGCTATCTCTCGAGAGATAGCTGTCAATATCCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-2708s1c1
Sequence:CCGGCGTCAAGAACTGGTCATGGATCTCGAGATCCATGACCAGTTCTTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-771s1c1
Sequence:CCGGGTTAACACCAAGCGGGTCATTCTCGAGAATGACCCGCTTGGTGTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-5855s1c1
Sequence:CCGGGAGCAAGGTCAAGAGCTACAACTCGAGTTGTAGCTCTTGACCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020884.1-3164s1c1
Sequence:CCGGGAAGAACCTGACGGAAGAGATCTCGAGATCTCTTCCGTCAGGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020884.1-1685s1c1
Sequence:CCGGGCAGTTCTTCAACCAGCACATCTCGAGATGTGCTGGTTGAAGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085378
MYH7B MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 7B, cardiac muscle, beta
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-1163s21c1
Sequence:CCGGGAGAAGTGTGCCTGCTATAAGCTCGAGCTTATAGCAGGCACACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-1798s21c1
Sequence:CCGGTTCTGGGAAGTCACCTAATTTCTCGAGAAATTAGGTGACTTCCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085378.1-5980s21c1
Sequence:CCGGTGCGATCCTGTTGTCTCTTTCCTCGAGGAAAGAGACAACAGGATCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-3975s21c1
Sequence:CCGGGGCGGTTACAAACGGAGAATGCTCGAGCATTCTCCGTTTGTAACCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085378
MYH7B MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 7B, cardiac muscle, beta
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-1163s21c1
Sequence:CCGGGAGAAGTGTGCCTGCTATAAGCTCGAGCTTATAGCAGGCACACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-1798s21c1
Sequence:CCGGTTCTGGGAAGTCACCTAATTTCTCGAGAAATTAGGTGACTTCCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085378.1-5980s21c1
Sequence:CCGGTGCGATCCTGTTGTCTCTTTCCTCGAGGAAAGAGACAACAGGATCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-3975s21c1
Sequence:CCGGGGCGGTTACAAACGGAGAATGCTCGAGCATTCTCCGTTTGTAACCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085378
MYH7B MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 7B, cardiac muscle, beta
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-1163s21c1
Sequence:CCGGGAGAAGTGTGCCTGCTATAAGCTCGAGCTTATAGCAGGCACACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-1798s21c1
Sequence:CCGGTTCTGGGAAGTCACCTAATTTCTCGAGAAATTAGGTGACTTCCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085378.1-5980s21c1
Sequence:CCGGTGCGATCCTGTTGTCTCTTTCCTCGAGGAAAGAGACAACAGGATCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085378.1-3975s21c1
Sequence:CCGGGGCGGTTACAAACGGAGAATGCTCGAGCATTCTCCGTTTGTAACCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)