EMAIL THIS PAGE TO A FRIEND

MYH8

myosin, heavy chain 8, skeletal muscle, perinatal

50 Gene Product Result for
Synonyms: MyHC-peri MyHC-pn gtMHC-F
UniProtKB ID: P13535, Q14910
Gene ID:
Human(4626) Summary: Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is predominantly expressed in fetal skeletal muscle. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in trismus-pseudocamptodactyly syndrome. [provided by RefSeq, Sep 2009]
Mouse(17885) myosin, heavy polypeptide 8, skeletal muscle, perinatal
Rat(252942) myosin, heavy chain 8, skeletal muscle, perinatal
domestic cat(101084146) myosin, heavy chain 8, skeletal muscle, perinatal
cow(281339) myosin, heavy chain 8, skeletal muscle, perinatal
Horse(100062893) myosin, heavy chain 8, skeletal muscle, perinatal
dog(403808) myosin, heavy chain 8, skeletal muscle, perinatal
domestic guinea pig(100726177) myosin, heavy chain 8, skeletal muscle, perinatal
naked mole-rat(101697917) myosin, heavy chain 8, skeletal muscle, perinatal
sheep(101111723) myosin, heavy chain 8, skeletal muscle, perinatal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002472 Rosetta Predictions human pricing
XM_001078049 Rosetta Predictions rat pricing
XM_001078064 Rosetta Predictions rat pricing
XM_001080186 Rosetta Predictions rat pricing
NM_177369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142084 predicted 973
2 SASI_Hs01_00142085 predicted 2341
3 SASI_Hs01_00142086 predicted 4385
4 SASI_Hs01_00142087 predicted 5757
5 SASI_Hs01_00142089 predicted 5331
6 SASI_Hs01_00142090 predicted 2099
7 SASI_Hs01_00142092 predicted 2488
8 SASI_Hs02_00333899 predicted 4440
9 SASI_Hs02_00333900 predicted 3568
10 SASI_Hs02_00333901 predicted 4804
11 SASI_Hs01_00142088 predicted 943
12 SASI_Hs01_00142091 predicted 4553
13 SASI_Hs01_00142093 predicted 5235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359499 predicted 3150
2 SASI_Rn02_00359500 predicted 598
3 SASI_Rn02_00359501 predicted 527
4 SASI_Rn02_00359502 predicted 597
5 SASI_Rn02_00359503 predicted 1837
6 SASI_Rn02_00359504 predicted 1513
7 SASI_Rn02_00359505 predicted 1836
8 SASI_Rn02_00359506 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359557 predicted 2085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366978 predicted 741
2 SASI_Rn02_00366979 predicted 5532
3 SASI_Rn02_00366980 predicted 5239
4 SASI_Rn02_00366981 predicted 5514
5 SASI_Rn02_00366982 predicted 239
6 SASI_Rn02_00366983 predicted 5591
7 SASI_Rn02_00366984 predicted 807
8 SASI_Rn02_00366985 predicted 2276
9 SASI_Rn02_00366986 predicted 207
10 SASI_Rn02_00366987 predicted 5620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103881 predicted 1019
2 SASI_Mm01_00103882 predicted 5765
3 SASI_Mm02_00347526 predicted 919
4 SASI_Mm01_00103885 predicted 2192
5 SASI_Mm01_00103886 predicted 4958
6 SASI_Mm01_00103887 predicted 2452
7 SASI_Mm01_00103888 predicted 422
8 SASI_Mm01_00103889 predicted 1226
9 SASI_Mm01_00103890 predicted 2610
10 SASI_Mm02_00347527 predicted 2431
11 SASI_Mm01_00103883 predicted 2379
12 SASI_Mm01_00103884 predicted 5021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177369
MYH8 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 8, skeletal muscle, perinatal
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-3692s1c1
Sequence:CCGGCGGGAAACTGAGTTTCAGAAACTCGAGTTTCTGAAACTCAGTTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-317s1c1
Sequence:CCGGCCCAAGGAGTCTTATGTGAAACTCGAGTTTCACATAAGACTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-5687s1c1
Sequence:CCGGCGCAATGCTGAGGCTGTTAAACTCGAGTTTAACAGCCTCAGCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-2608s1c1
Sequence:CCGGGCTGAGAAGAGAATCCATCTTCTCGAGAAGATGGATTCTCTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-1436s1c1
Sequence:CCGGCAGACGGTTCAACAAGTGTATCTCGAGATACACTTGTTGAACCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177369
MYH8 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 8, skeletal muscle, perinatal
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-3692s1c1
Sequence:CCGGCGGGAAACTGAGTTTCAGAAACTCGAGTTTCTGAAACTCAGTTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-317s1c1
Sequence:CCGGCCCAAGGAGTCTTATGTGAAACTCGAGTTTCACATAAGACTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-5687s1c1
Sequence:CCGGCGCAATGCTGAGGCTGTTAAACTCGAGTTTAACAGCCTCAGCATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-2608s1c1
Sequence:CCGGGCTGAGAAGAGAATCCATCTTCTCGAGAAGATGGATTCTCTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-1436s1c1
Sequence:CCGGCAGACGGTTCAACAAGTGTATCTCGAGATACACTTGTTGAACCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177369
MYH8 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 8, skeletal muscle, perinatal
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-3692s1c1
Sequence:CCGGCGGGAAACTGAGTTTCAGAAACTCGAGTTTCTGAAACTCAGTTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-317s1c1
Sequence:CCGGCCCAAGGAGTCTTATGTGAAACTCGAGTTTCACATAAGACTCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-5687s1c1
Sequence:CCGGCGCAATGCTGAGGCTGTTAAACTCGAGTTTAACAGCCTCAGCATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-2608s1c1
Sequence:CCGGGCTGAGAAGAGAATCCATCTTCTCGAGAAGATGGATTCTCTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177369.3-1436s1c1
Sequence:CCGGCAGACGGTTCAACAAGTGTATCTCGAGATACACTTGTTGAACCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002472
MYH8 MISSION shRNA Bacterial Glycerol Stock
myosin, heavy chain 8, skeletal muscle, perinatal
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-5582s1c1
Sequence:CCGGGCAGAGGCTGTTAAAGGTTTACTCGAGTAAACCTTTAACAGCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-3933s1c1
Sequence:CCGGCGGGTGAATATTCTCGACAATCTCGAGATTGTCGAGAATATTCACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-4001s1c1
Sequence:CCGGGCATCTACTCAGCAGATTGAACTCGAGTTCAATCTGCTGAGTAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-2463s1c1
Sequence:CCGGGATTCCTAATGAGGGTAGAATCTCGAGATTCTACCCTCATTAGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-5236s1c1
Sequence:CCGGCCAGAATACCAGTCTCATTAACTCGAGTTAATGAGACTGGTATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-3947s1c1
Sequence:CCGGCGACAATTAGATGAGCAAGATCTCGAGATCTTGCTCATCTAATTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-1112s1c1
Sequence:CCGGGAAGAGAAAGTGTCCATCTATCTCGAGATAGATGGACACTTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-3965s1c1
Sequence:CCGGGATGCTTTAGTCTCTCAGCTTCTCGAGAAGCTGAGAGACTAAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002472
MYH8 MISSION shRNA shRNA Plasmid DNA
myosin, heavy chain 8, skeletal muscle, perinatal
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-5582s1c1
Sequence:CCGGGCAGAGGCTGTTAAAGGTTTACTCGAGTAAACCTTTAACAGCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-3933s1c1
Sequence:CCGGCGGGTGAATATTCTCGACAATCTCGAGATTGTCGAGAATATTCACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-4001s1c1
Sequence:CCGGGCATCTACTCAGCAGATTGAACTCGAGTTCAATCTGCTGAGTAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-2463s1c1
Sequence:CCGGGATTCCTAATGAGGGTAGAATCTCGAGATTCTACCCTCATTAGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-5236s1c1
Sequence:CCGGCCAGAATACCAGTCTCATTAACTCGAGTTAATGAGACTGGTATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-3947s1c1
Sequence:CCGGCGACAATTAGATGAGCAAGATCTCGAGATCTTGCTCATCTAATTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-1112s1c1
Sequence:CCGGGAAGAGAAAGTGTCCATCTATCTCGAGATAGATGGACACTTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-3965s1c1
Sequence:CCGGGATGCTTTAGTCTCTCAGCTTCTCGAGAAGCTGAGAGACTAAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002472
MYH8 MISSION shRNA Lentiviral Transduction Particles
myosin, heavy chain 8, skeletal muscle, perinatal
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-5582s1c1
Sequence:CCGGGCAGAGGCTGTTAAAGGTTTACTCGAGTAAACCTTTAACAGCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-3933s1c1
Sequence:CCGGCGGGTGAATATTCTCGACAATCTCGAGATTGTCGAGAATATTCACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-4001s1c1
Sequence:CCGGGCATCTACTCAGCAGATTGAACTCGAGTTCAATCTGCTGAGTAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-2463s1c1
Sequence:CCGGGATTCCTAATGAGGGTAGAATCTCGAGATTCTACCCTCATTAGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-5236s1c1
Sequence:CCGGCCAGAATACCAGTCTCATTAACTCGAGTTAATGAGACTGGTATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002472.1-3947s1c1
Sequence:CCGGCGACAATTAGATGAGCAAGATCTCGAGATCTTGCTCATCTAATTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-1112s1c1
Sequence:CCGGGAAGAGAAAGTGTCCATCTATCTCGAGATAGATGGACACTTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002472.1-3965s1c1
Sequence:CCGGGATGCTTTAGTCTCTCAGCTTCTCGAGAAGCTGAGAGACTAAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)