EMAIL THIS PAGE TO A FRIEND

MYL10

myosin, light chain 10, regulatory

57 Gene Product Result for
Synonyms: MYLC2PL PLRLC
UniProtKB ID: Q9BUA6
Gene ID:
Mouse(59310) myosin, light chain 10, regulatory
Rat(501831) myosin, light chain 10, regulatory
Zebrafish(550569) myosin, light chain 10, regulatory
cow(617357) myosin, light chain 10, regulatory
domestic cat(101082365) myosin, light chain 10, regulatory
dog(608177) myosin, light chain 10, regulatory
chicken(417506) myosin, light chain 10, regulatory
naked mole-rat(101698311) myosin, light chain 10, regulatory
domestic guinea pig(100731839) myosin, light chain 10, regulatory
sheep(101118074) myosin, light chain 10, regulatory
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0734 AQUA Peptide EAFTIMDQN[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138403 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119981 MISSION® esiRNA esiRNA human AC004953.2-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138403 Rosetta Predictions human pricing
XM_577243 Rosetta Predictions rat pricing
NM_001085387 Rosetta Predictions mouse pricing
NM_021611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229698 predicted 351
2 SASI_Hs01_00229699 predicted 490
3 SASI_Hs01_00229700 predicted 472
4 SASI_Hs01_00229701 predicted 563
5 SASI_Hs01_00229702 predicted 511
6 SASI_Hs01_00229703 predicted 314
7 SASI_Hs01_00229704 predicted 478
8 SASI_Hs01_00229705 predicted 637
9 SASI_Hs01_00229706 predicted 502
10 SASI_Hs02_00363548 predicted 299
11 SASI_Hs01_00229707 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406365 predicted 399
2 SASI_Rn02_00406366 predicted 261
3 SASI_Rn02_00406367 predicted 225
4 SASI_Rn02_00406368 predicted 222
5 SASI_Rn02_00406369 predicted 264
6 SASI_Rn02_00406370 predicted 359
7 SASI_Rn02_00406371 predicted 339
8 SASI_Rn02_00406372 predicted 364
9 SASI_Rn02_00406373 predicted 399
10 SASI_Rn02_00406374 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300295 predicted 299
2 SASI_Mm02_00300296 predicted 335
3 SASI_Mm02_00300297 predicted 360
4 SASI_Mm02_00300298 predicted 294
5 SASI_Mm02_00300299 predicted 298
6 SASI_Mm02_00300300 predicted 263
7 SASI_Mm02_00300301 predicted 371
8 SASI_Mm02_00300302 predicted 291
9 SASI_Mm02_00300303 predicted 337
10 SASI_Mm02_00300304 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326380 predicted 514
2 SASI_Mm02_00326381 predicted 550
3 SASI_Mm02_00326382 predicted 569
4 SASI_Mm01_00172903 predicted 512
5 SASI_Mm01_00172905 predicted 510
6 SASI_Mm02_00326383 predicted 476
7 SASI_Mm02_00326384 predicted 579
8 SASI_Mm02_00326385 predicted 512
9 SASI_Mm02_00326386 predicted 551
10 SASI_Mm02_00326387 predicted 512
11 SASI_Mm01_00172899 predicted 317
12 SASI_Mm01_00172900 predicted 347
13 SASI_Mm01_00172901 predicted 564
14 SASI_Mm01_00172902 predicted 361
15 SASI_Mm01_00172904 predicted 225
16 SASI_Mm01_00172906 predicted 466
17 SASI_Mm01_00172907 predicted 234
18 SASI_Mm01_00172908 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021611
MYL10 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 10, regulatory
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-629s1c1
Sequence:CCGGCAGGAATCTGTGCTACGTCATCTCGAGATGACGTAGCACAGATTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-602s1c1
Sequence:CCGGGCCAGATGTCTGTGGCAACTTCTCGAGAAGTTGCCACAGACATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-130s1c1
Sequence:CCGGCTCTGAAAGAGGCAACAGCTACTCGAGTAGCTGTTGCCTCTTTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-471s1c1
Sequence:CCGGCTGCACGCCTTCAAAGTGTTTCTCGAGAAACACTTTGAAGGCGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-570s1c1
Sequence:CCGGGAGGAGGTCAAGCAGATGTTTCTCGAGAAACATCTGCTTGACCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-297s21c1
Sequence:CCGGCCGCGATGGCTTCATTGACAACTCGAGTTGTCAATGAAGCCATCGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-356s21c1
Sequence:CCGGTAAATGTCAAGAACGAGGAATCTCGAGATTCCTCGTTCTTGACATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-340s21c1
Sequence:CCGGGCTGCACTGGGTCGCATAAATCTCGAGATTTATGCGACCCAGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021611
MYL10 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 10, regulatory
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-629s1c1
Sequence:CCGGCAGGAATCTGTGCTACGTCATCTCGAGATGACGTAGCACAGATTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-602s1c1
Sequence:CCGGGCCAGATGTCTGTGGCAACTTCTCGAGAAGTTGCCACAGACATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-130s1c1
Sequence:CCGGCTCTGAAAGAGGCAACAGCTACTCGAGTAGCTGTTGCCTCTTTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-471s1c1
Sequence:CCGGCTGCACGCCTTCAAAGTGTTTCTCGAGAAACACTTTGAAGGCGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-570s1c1
Sequence:CCGGGAGGAGGTCAAGCAGATGTTTCTCGAGAAACATCTGCTTGACCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-297s21c1
Sequence:CCGGCCGCGATGGCTTCATTGACAACTCGAGTTGTCAATGAAGCCATCGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-356s21c1
Sequence:CCGGTAAATGTCAAGAACGAGGAATCTCGAGATTCCTCGTTCTTGACATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-340s21c1
Sequence:CCGGGCTGCACTGGGTCGCATAAATCTCGAGATTTATGCGACCCAGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021611
MYL10 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 10, regulatory
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-629s1c1
Sequence:CCGGCAGGAATCTGTGCTACGTCATCTCGAGATGACGTAGCACAGATTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-602s1c1
Sequence:CCGGGCCAGATGTCTGTGGCAACTTCTCGAGAAGTTGCCACAGACATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-130s1c1
Sequence:CCGGCTCTGAAAGAGGCAACAGCTACTCGAGTAGCTGTTGCCTCTTTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-471s1c1
Sequence:CCGGCTGCACGCCTTCAAAGTGTTTCTCGAGAAACACTTTGAAGGCGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021611.1-570s1c1
Sequence:CCGGGAGGAGGTCAAGCAGATGTTTCTCGAGAAACATCTGCTTGACCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-297s21c1
Sequence:CCGGCCGCGATGGCTTCATTGACAACTCGAGTTGTCAATGAAGCCATCGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-356s21c1
Sequence:CCGGTAAATGTCAAGAACGAGGAATCTCGAGATTCCTCGTTCTTGACATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021611.2-340s21c1
Sequence:CCGGGCTGCACTGGGTCGCATAAATCTCGAGATTTATGCGACCCAGTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138403
MYL10 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 10, regulatory
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-498s1c1
Sequence:CCGGCGACACTGAAGGGAAAGGTTTCTCGAGAAACCTTTCCCTTCAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-79s1c1
Sequence:CCGGGCACCGAGAAGAGCTCGGAAACTCGAGTTTCCGAGCTCTTCTCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-319s1c1
Sequence:CCGGGAGGACTTGAGGGACACCTTTCTCGAGAAAGGTGTCCCTCAAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-504s1c1
Sequence:CCGGTGAAGGGAAAGGTTTCGTCAACTCGAGTTGACGAAACCTTTCCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-524s1c1
Sequence:CCGGAGGCCGATGTCATCAAAGAAACTCGAGTTTCTTTGATGACATCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-657s21c1
Sequence:CCGGTCCACGCCTTCAAAGTGTTCGCTCGAGCGAACACTTTGAAGGCGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-582s21c1
Sequence:CCGGGACCCATCAACTTCACGGTGTCTCGAGACACCGTGAAGTTGATGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-763s21c1
Sequence:CCGGCAAGCAGATGTTTGCAGCATTCTCGAGAATGCTGCAAACATCTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-528s21c1
Sequence:CCGGGCCGCATCAATGTCAAGAACGCTCGAGCGTTCTTGACATTGATGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-746s21c1
Sequence:CCGGTTCAGTGAGGAGGAGGTCAAGCTCGAGCTTGACCTCCTCCTCACTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-829s21c1
Sequence:CCGGCGTCATCACTCACGGTGAAGACTCGAGTCTTCACCGTGAGTGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138403
MYL10 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 10, regulatory
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-498s1c1
Sequence:CCGGCGACACTGAAGGGAAAGGTTTCTCGAGAAACCTTTCCCTTCAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-79s1c1
Sequence:CCGGGCACCGAGAAGAGCTCGGAAACTCGAGTTTCCGAGCTCTTCTCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-319s1c1
Sequence:CCGGGAGGACTTGAGGGACACCTTTCTCGAGAAAGGTGTCCCTCAAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-504s1c1
Sequence:CCGGTGAAGGGAAAGGTTTCGTCAACTCGAGTTGACGAAACCTTTCCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-524s1c1
Sequence:CCGGAGGCCGATGTCATCAAAGAAACTCGAGTTTCTTTGATGACATCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-657s21c1
Sequence:CCGGTCCACGCCTTCAAAGTGTTCGCTCGAGCGAACACTTTGAAGGCGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-582s21c1
Sequence:CCGGGACCCATCAACTTCACGGTGTCTCGAGACACCGTGAAGTTGATGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-763s21c1
Sequence:CCGGCAAGCAGATGTTTGCAGCATTCTCGAGAATGCTGCAAACATCTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-528s21c1
Sequence:CCGGGCCGCATCAATGTCAAGAACGCTCGAGCGTTCTTGACATTGATGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-746s21c1
Sequence:CCGGTTCAGTGAGGAGGAGGTCAAGCTCGAGCTTGACCTCCTCCTCACTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-829s21c1
Sequence:CCGGCGTCATCACTCACGGTGAAGACTCGAGTCTTCACCGTGAGTGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138403
MYL10 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 10, regulatory
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-498s1c1
Sequence:CCGGCGACACTGAAGGGAAAGGTTTCTCGAGAAACCTTTCCCTTCAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-79s1c1
Sequence:CCGGGCACCGAGAAGAGCTCGGAAACTCGAGTTTCCGAGCTCTTCTCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-319s1c1
Sequence:CCGGGAGGACTTGAGGGACACCTTTCTCGAGAAAGGTGTCCCTCAAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-504s1c1
Sequence:CCGGTGAAGGGAAAGGTTTCGTCAACTCGAGTTGACGAAACCTTTCCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138403.3-524s1c1
Sequence:CCGGAGGCCGATGTCATCAAAGAAACTCGAGTTTCTTTGATGACATCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-657s21c1
Sequence:CCGGTCCACGCCTTCAAAGTGTTCGCTCGAGCGAACACTTTGAAGGCGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-582s21c1
Sequence:CCGGGACCCATCAACTTCACGGTGTCTCGAGACACCGTGAAGTTGATGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-763s21c1
Sequence:CCGGCAAGCAGATGTTTGCAGCATTCTCGAGAATGCTGCAAACATCTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-528s21c1
Sequence:CCGGGCCGCATCAATGTCAAGAACGCTCGAGCGTTCTTGACATTGATGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-746s21c1
Sequence:CCGGTTCAGTGAGGAGGAGGTCAAGCTCGAGCTTGACCTCCTCCTCACTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138403.4-829s21c1
Sequence:CCGGCGTCATCACTCACGGTGAAGACTCGAGTCTTCACCGTGAGTGATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)