EMAIL THIS PAGE TO A FRIEND

MYL12A

myosin, light chain 12A, regulatory, non-sarcomeric

55 Gene Product Result for
Synonyms: MLCB MRCL3 MRLC3 MYL2B
UniProtKB ID: P19105
Gene ID:
Mouse(67268) myosin, light chain 12A, regulatory, non-sarcomeric
Rat(501203) myosin, light chain 12A, regulatory, non-sarcomeric
chicken(396284) myosin, light chain 12A, regulatory, non-sarcomeric
dog(607207) myosin regulatory light polypeptide 9-like
cow(531505) myosin, light chain 12A, regulatory, non-sarcomeric
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101690 Anti-MRCL3 (1-13) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4300424 Anti-MRCL3 (Ab-18) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, western blot pricing
SAB4300093 Anti-phospho-MRCL3 (pSer18) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006471 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006471 Rosetta Predictions human pricing
NM_001135017 Rosetta Predictions rat pricing
XM_343643 Rosetta Predictions rat pricing
NM_026064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230849 predicted 944
2 SASI_Hs01_00230850 predicted 578
3 SASI_Hs01_00230851 predicted 931
4 SASI_Hs01_00230853 predicted 403
5 SASI_Hs01_00230854 predicted 967
6 SASI_Hs01_00230855 predicted 917
7 SASI_Hs01_00230857 predicted 931
8 SASI_Hs01_00230858 predicted 930
9 SASI_Hs02_00341647 predicted 999
10 SASI_Hs02_00341648 predicted 1010
11 SASI_Hs01_00230852 predicted 906
12 SASI_Hs01_00230856 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259490 predicted 286
2 SASI_Rn02_00259491 predicted 660
3 SASI_Rn02_00259492 predicted 645
4 SASI_Rn02_00259493 predicted 843
5 SASI_Rn02_00259494 predicted 866
6 SASI_Rn02_00259495 predicted 909
7 SASI_Rn02_00259496 predicted 888
8 SASI_Rn02_00259497 predicted 837
9 SASI_Rn02_00259498 predicted 831
10 SASI_Rn02_00259499 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192888 predicted 457
2 SASI_Rn01_00192889 predicted 200
3 SASI_Rn01_00192890 predicted 377
4 SASI_Rn01_00192891 predicted 446
5 SASI_Rn01_00192892 predicted 1184
6 SASI_Rn01_00192893 predicted 330
7 SASI_Rn01_00192894 predicted 443
8 SASI_Rn01_00192895 predicted 213
9 SASI_Rn01_00192896 predicted 465
10 SASI_Rn01_00192897 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137951 predicted 1392
2 SASI_Mm01_00137952 predicted 1291
3 SASI_Mm01_00137953 predicted 1277
4 SASI_Mm01_00137958 predicted 1226
5 SASI_Mm01_00137954 predicted 1277
6 SASI_Mm01_00137955 predicted 1444
7 SASI_Mm01_00137956 predicted 1286
8 SASI_Mm01_00137957 predicted 1024
9 SASI_Mm01_00137959 predicted 1133
10 SASI_Mm02_00329605 predicted 1142
11 SASI_Mm01_00137960 predicted 939
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006471
VALIDATED
MYL12A MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 12A, regulatory, non-sarcomeric
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-555s21c1
Sequence:CCGGCATGATATGCTTGCTTCATTGCTCGAGCAATGAAGCAAGCATATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-1055s21c1
Sequence:CCGGCAGACTGGAAACGGGACTTTCCTCGAGGAAAGTCCCGTTTCCAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-687s21c1
Sequence:CCGGCCTGAAGATGTCATCAGAAATCTCGAGATTTCTGATGACATCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-578s21c1
Sequence:CCGGGAAGAATCCAACTGATGAGTACTCGAGTACTCATCAGTTGGATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-578s1c1
Sequence:CCGGGAAGAATCCAACTGATGAGTACTCGAGTACTCATCAGTTGGATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-687s1c1
Sequence:CCGGCCTGAAGATGTCATCAGAAATCTCGAGATTTCTGATGACATCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-585s1c1
Sequence:CCGGCCAACTGATGAGTATCTAGATCTCGAGATCTAGATACTCATCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006471.2-650s1c1
Sequence:CCGGCCTCACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006471
VALIDATED
MYL12A MISSION shRNA shRNA Plasmid DNA
myosin, light chain 12A, regulatory, non-sarcomeric
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-555s21c1
Sequence:CCGGCATGATATGCTTGCTTCATTGCTCGAGCAATGAAGCAAGCATATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-1055s21c1
Sequence:CCGGCAGACTGGAAACGGGACTTTCCTCGAGGAAAGTCCCGTTTCCAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-687s21c1
Sequence:CCGGCCTGAAGATGTCATCAGAAATCTCGAGATTTCTGATGACATCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-578s21c1
Sequence:CCGGGAAGAATCCAACTGATGAGTACTCGAGTACTCATCAGTTGGATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-578s1c1
Sequence:CCGGGAAGAATCCAACTGATGAGTACTCGAGTACTCATCAGTTGGATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-687s1c1
Sequence:CCGGCCTGAAGATGTCATCAGAAATCTCGAGATTTCTGATGACATCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-585s1c1
Sequence:CCGGCCAACTGATGAGTATCTAGATCTCGAGATCTAGATACTCATCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006471.2-650s1c1
Sequence:CCGGCCTCACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006471
VALIDATED
MYL12A MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 12A, regulatory, non-sarcomeric
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-555s21c1
Sequence:CCGGCATGATATGCTTGCTTCATTGCTCGAGCAATGAAGCAAGCATATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-1055s21c1
Sequence:CCGGCAGACTGGAAACGGGACTTTCCTCGAGGAAAGTCCCGTTTCCAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-687s21c1
Sequence:CCGGCCTGAAGATGTCATCAGAAATCTCGAGATTTCTGATGACATCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006471.2-578s21c1
Sequence:CCGGGAAGAATCCAACTGATGAGTACTCGAGTACTCATCAGTTGGATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-578s1c1
Sequence:CCGGGAAGAATCCAACTGATGAGTACTCGAGTACTCATCAGTTGGATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-687s1c1
Sequence:CCGGCCTGAAGATGTCATCAGAAATCTCGAGATTTCTGATGACATCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006471.2-585s1c1
Sequence:CCGGCCAACTGATGAGTATCTAGATCTCGAGATCTAGATACTCATCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006471.2-650s1c1
Sequence:CCGGCCTCACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026064
VALIDATED
MYL12A MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 12A, regulatory, non-sarcomeric
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-691s21c1
Sequence:CCGGACCATGTTCCTCACCATGTTTCTCGAGAAACATGGTGAGGAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-897s21c1
Sequence:CCGGGAACTTCAACTACATTGAGTTCTCGAGAACTCAATGTAGTTGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026064.2-1481s21c1
Sequence:CCGGCCCTAGACTTTGTCTTTCTTTCTCGAGAAAGAAAGACAAAGTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-552s21c1
Sequence:CCGGCTTTAACATGATTGACCAGAACTCGAGTTCTGGTCAATCATGTTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-534s21c1
Sequence:CCGGCCAGGAGTTCAAAGAAGCCTTCTCGAGAAGGCTTCTTTGAACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-534s1c1
Sequence:CCGGCCAGGAGTTCAAAGAAGCCTTCTCGAGAAGGCTTCTTTGAACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026064.2-691s1c1
Sequence:CCGGACCATGTTCCTCACCATGTTTCTCGAGAAACATGGTGAGGAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-552s1c1
Sequence:CCGGCTTTAACATGATTGACCAGAACTCGAGTTCTGGTCAATCATGTTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026064.2-1481s1c1
Sequence:CCGGCCCTAGACTTTGTCTTTCTTTCTCGAGAAAGAAAGACAAAGTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-897s1c1
Sequence:CCGGGAACTTCAACTACATTGAGTTCTCGAGAACTCAATGTAGTTGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026064
VALIDATED
MYL12A MISSION shRNA shRNA Plasmid DNA
myosin, light chain 12A, regulatory, non-sarcomeric
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-691s21c1
Sequence:CCGGACCATGTTCCTCACCATGTTTCTCGAGAAACATGGTGAGGAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-897s21c1
Sequence:CCGGGAACTTCAACTACATTGAGTTCTCGAGAACTCAATGTAGTTGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026064.2-1481s21c1
Sequence:CCGGCCCTAGACTTTGTCTTTCTTTCTCGAGAAAGAAAGACAAAGTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-552s21c1
Sequence:CCGGCTTTAACATGATTGACCAGAACTCGAGTTCTGGTCAATCATGTTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-534s21c1
Sequence:CCGGCCAGGAGTTCAAAGAAGCCTTCTCGAGAAGGCTTCTTTGAACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-534s1c1
Sequence:CCGGCCAGGAGTTCAAAGAAGCCTTCTCGAGAAGGCTTCTTTGAACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026064.2-691s1c1
Sequence:CCGGACCATGTTCCTCACCATGTTTCTCGAGAAACATGGTGAGGAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-552s1c1
Sequence:CCGGCTTTAACATGATTGACCAGAACTCGAGTTCTGGTCAATCATGTTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026064.2-1481s1c1
Sequence:CCGGCCCTAGACTTTGTCTTTCTTTCTCGAGAAAGAAAGACAAAGTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-897s1c1
Sequence:CCGGGAACTTCAACTACATTGAGTTCTCGAGAACTCAATGTAGTTGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026064
VALIDATED
MYL12A MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 12A, regulatory, non-sarcomeric
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-691s21c1
Sequence:CCGGACCATGTTCCTCACCATGTTTCTCGAGAAACATGGTGAGGAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-897s21c1
Sequence:CCGGGAACTTCAACTACATTGAGTTCTCGAGAACTCAATGTAGTTGAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026064.2-1481s21c1
Sequence:CCGGCCCTAGACTTTGTCTTTCTTTCTCGAGAAAGAAAGACAAAGTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-552s21c1
Sequence:CCGGCTTTAACATGATTGACCAGAACTCGAGTTCTGGTCAATCATGTTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026064.2-534s21c1
Sequence:CCGGCCAGGAGTTCAAAGAAGCCTTCTCGAGAAGGCTTCTTTGAACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-534s1c1
Sequence:CCGGCCAGGAGTTCAAAGAAGCCTTCTCGAGAAGGCTTCTTTGAACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026064.2-691s1c1
Sequence:CCGGACCATGTTCCTCACCATGTTTCTCGAGAAACATGGTGAGGAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-552s1c1
Sequence:CCGGCTTTAACATGATTGACCAGAACTCGAGTTCTGGTCAATCATGTTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026064.2-1481s1c1
Sequence:CCGGCCCTAGACTTTGTCTTTCTTTCTCGAGAAAGAAAGACAAAGTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026064.2-897s1c1
Sequence:CCGGGAACTTCAACTACATTGAGTTCTCGAGAACTCAATGTAGTTGAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)