EMAIL THIS PAGE TO A FRIEND

MYL12B

myosin, light chain 12B, regulatory

101 Gene Product Result for
Synonyms: MLC-B MRLC2
UniProtKB ID: O14950, D3DUH6, Q13182, Q7Z5Z4
Gene ID:
Human(103910) Summary: The activity of nonmuscle myosin II (see MYH9; MIM 160775) is regulated by phosphorylation of a regulatory light chain, such as MRLC2. This phosphorylation results in higher MgATPase activity and the assembly of myosin II filaments (Iwasaki et al., 2001 [PubMed 11942626]
Mouse(67938) myosin, light chain 12B, regulatory
Rat(50685) myosin, light chain 12B, regulatory
naked mole-rat(101697884) myosin, light chain 12B, regulatory
sheep(101105123) myosin, light chain 12B, regulatory
dog(480193) myosin regulatory light polypeptide 9-like
domestic cat(101085247) myosin, light chain 12B, regulatory
cow(614055) myosin, light chain 12B, regulatory
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033546 Rosetta Predictions human pricing
NM_017343 Rosetta Predictions rat pricing
XM_579412 Rosetta Predictions rat pricing
NM_023402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148342 predicted 626
2 SASI_Hs01_00148343 predicted 645
3 SASI_Hs01_00148344 predicted 622
4 SASI_Hs01_00148345 predicted 618
5 SASI_Hs01_00148347 predicted 713
6 SASI_Hs01_00148348 predicted 122
7 SASI_Hs01_00148346 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261807 predicted 617
2 SASI_Rn02_00261808 predicted 918
3 SASI_Rn02_00261809 predicted 931
4 SASI_Rn02_00261810 predicted 933
5 SASI_Rn02_00261811 predicted 628
6 SASI_Rn02_00261812 predicted 627
7 SASI_Rn01_00084232 predicted 738
8 SASI_Rn01_00084236 predicted 680
9 SASI_Rn02_00261813 predicted 879
10 SASI_Rn02_00261814 predicted 965
11 SASI_Rn01_00084228 predicted 405
12 SASI_Rn01_00084229 predicted 529
13 SASI_Rn01_00084230 predicted 902
14 SASI_Rn01_00084231 predicted 736
15 SASI_Rn01_00084233 predicted 781
16 SASI_Rn01_00084234 predicted 863
17 SASI_Rn01_00084235 predicted 906
18 SASI_Rn01_00084237 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136797 predicted 659
2 SASI_Rn01_00136798 predicted 786
3 SASI_Rn01_00136799 predicted 605
4 SASI_Rn01_00136800 predicted 799
5 SASI_Rn01_00136801 predicted 696
6 SASI_Rn01_00136802 predicted 705
7 SASI_Rn01_00136803 predicted 779
8 SASI_Rn01_00136804 predicted 652
9 SASI_Rn01_00136805 predicted 643
10 SASI_Rn01_00136806 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327097 predicted 243
2 SASI_Mm02_00327098 predicted 798
3 SASI_Mm02_00327099 predicted 658
4 SASI_Mm02_00327100 predicted 846
5 SASI_Mm02_00327101 predicted 762
6 SASI_Mm02_00327102 predicted 650
7 SASI_Mm02_00327103 predicted 760
8 SASI_Mm02_00327104 predicted 848
9 SASI_Mm02_00327105 predicted 804
10 SASI_Mm02_00327106 predicted 590
11 SASI_Mm01_00082005 predicted 385
12 SASI_Mm01_00082006 predicted 374
13 SASI_Mm01_00082007 predicted 406
14 SASI_Mm01_00082008 predicted 473
15 SASI_Mm01_00082009 predicted 380
16 SASI_Mm01_00082010 predicted 410
17 SASI_Mm01_00082011 predicted 384
18 SASI_Mm01_00082012 predicted 373
19 SASI_Mm01_00082013 predicted 467
20 SASI_Mm01_00082014 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023402
VALIDATED
MYL12B MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 12B, regulatory
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-757s1c1
Sequence:CCGGGCCCTTTCTGTCACTTAGCATCTCGAGATGCTAAGTGACAGAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-155s1c1
Sequence:CCGGCAGGAGTTCAAAGAGGCCTTTCTCGAGAAAGGCCTCTTTGAACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-118s1c1
Sequence:CCGGCTCCAATGTGTTCGCCATGTTCTCGAGAACATGGCGAACACATTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-526s1c1
Sequence:CCGGCTACATTGAGTTCACACGCATCTCGAGATGCGTGTGAACTCAATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-371s1c1
Sequence:CCGGAGAAACGCCTTCGCTTGCTTTCTCGAGAAAGCAAGCGAAGGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-116s21c1
Sequence:CCGGCTCCAATGTGTTCGCCATGTTCTCGAGAACATGGCGAACACATTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-153s21c1
Sequence:CCGGCAGGAGTTCAAAGAGGCCTTTCTCGAGAAAGGCCTCTTTGAACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-369s21c1
Sequence:CCGGAGAAACGCCTTCGCTTGCTTTCTCGAGAAAGCAAGCGAAGGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-524s21c1
Sequence:CCGGCTACATTGAGTTCACACGCATCTCGAGATGCGTGTGAACTCAATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023402.2-755s21c1
Sequence:CCGGGCCCTTTCTGTCACTTAGCATCTCGAGATGCTAAGTGACAGAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023402
VALIDATED
MYL12B MISSION shRNA shRNA Plasmid DNA
myosin, light chain 12B, regulatory
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-757s1c1
Sequence:CCGGGCCCTTTCTGTCACTTAGCATCTCGAGATGCTAAGTGACAGAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-155s1c1
Sequence:CCGGCAGGAGTTCAAAGAGGCCTTTCTCGAGAAAGGCCTCTTTGAACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-118s1c1
Sequence:CCGGCTCCAATGTGTTCGCCATGTTCTCGAGAACATGGCGAACACATTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-526s1c1
Sequence:CCGGCTACATTGAGTTCACACGCATCTCGAGATGCGTGTGAACTCAATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-371s1c1
Sequence:CCGGAGAAACGCCTTCGCTTGCTTTCTCGAGAAAGCAAGCGAAGGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-116s21c1
Sequence:CCGGCTCCAATGTGTTCGCCATGTTCTCGAGAACATGGCGAACACATTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-153s21c1
Sequence:CCGGCAGGAGTTCAAAGAGGCCTTTCTCGAGAAAGGCCTCTTTGAACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-369s21c1
Sequence:CCGGAGAAACGCCTTCGCTTGCTTTCTCGAGAAAGCAAGCGAAGGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-524s21c1
Sequence:CCGGCTACATTGAGTTCACACGCATCTCGAGATGCGTGTGAACTCAATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023402.2-755s21c1
Sequence:CCGGGCCCTTTCTGTCACTTAGCATCTCGAGATGCTAAGTGACAGAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023402
VALIDATED
MYL12B MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 12B, regulatory
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-757s1c1
Sequence:CCGGGCCCTTTCTGTCACTTAGCATCTCGAGATGCTAAGTGACAGAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-155s1c1
Sequence:CCGGCAGGAGTTCAAAGAGGCCTTTCTCGAGAAAGGCCTCTTTGAACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-118s1c1
Sequence:CCGGCTCCAATGTGTTCGCCATGTTCTCGAGAACATGGCGAACACATTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-526s1c1
Sequence:CCGGCTACATTGAGTTCACACGCATCTCGAGATGCGTGTGAACTCAATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023402.1-371s1c1
Sequence:CCGGAGAAACGCCTTCGCTTGCTTTCTCGAGAAAGCAAGCGAAGGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-116s21c1
Sequence:CCGGCTCCAATGTGTTCGCCATGTTCTCGAGAACATGGCGAACACATTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-153s21c1
Sequence:CCGGCAGGAGTTCAAAGAGGCCTTTCTCGAGAAAGGCCTCTTTGAACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-369s21c1
Sequence:CCGGAGAAACGCCTTCGCTTGCTTTCTCGAGAAAGCAAGCGAAGGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023402.2-524s21c1
Sequence:CCGGCTACATTGAGTTCACACGCATCTCGAGATGCGTGTGAACTCAATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023402.2-755s21c1
Sequence:CCGGGCCCTTTCTGTCACTTAGCATCTCGAGATGCTAAGTGACAGAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033546
VALIDATED
MYL12B MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 12B, regulatory
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033546.2-351s1c1
Sequence:CCGGGCCAATCAATTTCACCATGTTCTCGAGAACATGGTGAAATTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-464s1c1
Sequence:CCGGCCATTCAGGAAGATTACCTAACTCGAGTTAGGTAATCTTCCTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-372s1c1
Sequence:CCGGCCTGACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-264s1c1
Sequence:CCGGCAAGGAAGATTTGCATGATATCTCGAGATATCATGCAAATCTTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-195s1c1
Sequence:CCGGCCAGTCACAGATTCAGGAGTTCTCGAGAACTCCTGAATCTGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-290s21c1
Sequence:CCGGCAAGGAAGATTTGCATGATATCTCGAGATATCATGCAAATCTTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-490s21c1
Sequence:CCGGCCATTCAGGAAGATTACCTAACTCGAGTTAGGTAATCTTCCTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-221s21c1
Sequence:CCGGCCAGTCACAGATTCAGGAGTTCTCGAGAACTCCTGAATCTGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-398s21c1
Sequence:CCGGCCTGACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033546
VALIDATED
MYL12B MISSION shRNA shRNA Plasmid DNA
myosin, light chain 12B, regulatory
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033546.2-351s1c1
Sequence:CCGGGCCAATCAATTTCACCATGTTCTCGAGAACATGGTGAAATTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-464s1c1
Sequence:CCGGCCATTCAGGAAGATTACCTAACTCGAGTTAGGTAATCTTCCTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-372s1c1
Sequence:CCGGCCTGACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-264s1c1
Sequence:CCGGCAAGGAAGATTTGCATGATATCTCGAGATATCATGCAAATCTTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-195s1c1
Sequence:CCGGCCAGTCACAGATTCAGGAGTTCTCGAGAACTCCTGAATCTGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-290s21c1
Sequence:CCGGCAAGGAAGATTTGCATGATATCTCGAGATATCATGCAAATCTTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-490s21c1
Sequence:CCGGCCATTCAGGAAGATTACCTAACTCGAGTTAGGTAATCTTCCTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-221s21c1
Sequence:CCGGCCAGTCACAGATTCAGGAGTTCTCGAGAACTCCTGAATCTGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-398s21c1
Sequence:CCGGCCTGACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033546
VALIDATED
MYL12B MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 12B, regulatory
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033546.2-351s1c1
Sequence:CCGGGCCAATCAATTTCACCATGTTCTCGAGAACATGGTGAAATTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-464s1c1
Sequence:CCGGCCATTCAGGAAGATTACCTAACTCGAGTTAGGTAATCTTCCTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-372s1c1
Sequence:CCGGCCTGACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-264s1c1
Sequence:CCGGCAAGGAAGATTTGCATGATATCTCGAGATATCATGCAAATCTTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033546.2-195s1c1
Sequence:CCGGCCAGTCACAGATTCAGGAGTTCTCGAGAACTCCTGAATCTGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-290s21c1
Sequence:CCGGCAAGGAAGATTTGCATGATATCTCGAGATATCATGCAAATCTTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-490s21c1
Sequence:CCGGCCATTCAGGAAGATTACCTAACTCGAGTTAGGTAATCTTCCTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-221s21c1
Sequence:CCGGCCAGTCACAGATTCAGGAGTTCTCGAGAACTCCTGAATCTGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033546.3-398s21c1
Sequence:CCGGCCTGACCATGTTTGGTGAGAACTCGAGTTCTCACCAAACATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)