EMAIL THIS PAGE TO A FRIEND

MYL1

myosin, light chain 1, alkali; skeletal, fast

98 Gene Product Result for
Synonyms: MLC1F MLC3F
UniProtKB ID: P05976, B2R4N6, B2R4T6, P06741, Q6IBD5
Gene ID:
Human(4632) Summary: Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in fast skeletal muscle. Two transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(17901) myosin, light polypeptide 1
Rat(56781) myosin, light chain 1
sheep(101101869) myosin, light chain 1, alkali; skeletal, fast
domestic guinea pig(100730483) myosin, light chain 1, alkali; skeletal, fast
naked mole-rat(101697738) myosin, light chain 1, alkali; skeletal, fast
Domestic Rabbit(100009400) myosin, light chain 1, alkali; skeletal, fast
Zebrafish(336165) myosin, light chain 1, alkali; skeletal, fast
dog(478896) myosin, light chain 1, alkali; skeletal, fast
cow(317657) myosin, light chain 1, alkali; skeletal, fast
domestic cat(101099140) myosin, light chain 1, alkali; skeletal, fast
chicken(396470) myosin, light chain 1, alkali; skeletal, fast
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409338 Anti-MYL1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2702072 Anti-MYL1 antibody produced in rabbit mouse, human, rat
immunocytochemistry, immunofluorescence, western blot pricing
M7523 Anti-Myosin (Skeletal) antibody produced in rabbit whole antiserum human
immunofluorescence, immunohistochemistry pricing
WH0004632M1 Monoclonal Anti-MYL1 antibody produced in mouse clone 2D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_079420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_079420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_079420 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080911 MISSION® esiRNA esiRNA human MYL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_079420 Rosetta Predictions human pricing
NM_079422 Rosetta Predictions human pricing
NM_001077656 Rosetta Predictions rat pricing
NM_020104 Rosetta Predictions rat pricing
NM_001113387 Rosetta Predictions mouse pricing
NM_021285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_079420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211618 predicted 629
2 SASI_Hs02_00362183 predicted 784
3 SASI_Hs01_00211619 predicted 506
4 SASI_Hs02_00362184 predicted 824
5 SASI_Hs02_00362185 predicted 717
6 SASI_Hs01_00211622 predicted 568
7 SASI_Hs01_00211624 predicted 635
8 SASI_Hs02_00362186 predicted 786
9 SASI_Hs01_00211625 predicted 662
10 SASI_Hs01_00211627 predicted 502
11 SASI_Hs01_00211620 predicted 505
12 SASI_Hs01_00211621 predicted 641
13 SASI_Hs01_00211623 predicted 513
14 SASI_Hs01_00211626 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_079422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084264 predicted 447
2 SASI_Hs02_00362188 predicted 594
3 SASI_Hs01_00084265 predicted 315
4 SASI_Hs02_00362189 predicted 627
5 SASI_Hs02_00362190 predicted 522
6 SASI_Hs01_00084268 predicted 379
7 SASI_Hs01_00084270 predicted 445
8 SASI_Hs02_00362191 predicted 595
9 SASI_Hs01_00084271 predicted 475
10 SASI_Hs01_00084273 predicted 313
11 SASI_Hs01_00084266 predicted 322
12 SASI_Hs01_00084267 predicted 450
13 SASI_Hs01_00084269 predicted 323
14 SASI_Hs01_00084272 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207752 predicted 727
2 SASI_Rn02_00207753 predicted 669
3 SASI_Rn02_00207754 predicted 720
4 SASI_Rn02_00207755 predicted 727
5 SASI_Rn02_00207756 predicted 481
6 SASI_Rn02_00207757 predicted 727
7 SASI_Rn02_00207758 predicted 486
8 SASI_Rn02_00207759 predicted 746
9 SASI_Rn02_00207760 predicted 744
10 SASI_Rn02_00207761 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262529 predicted 536
2 SASI_Rn02_00262530 predicted 483
3 SASI_Rn02_00262531 predicted 537
4 SASI_Rn02_00262532 predicted 549
5 SASI_Rn02_00262533 predicted 298
6 SASI_Rn02_00262534 predicted 541
7 SASI_Rn02_00262535 predicted 296
8 SASI_Rn02_00262536 predicted 560
9 SASI_Rn02_00262537 predicted 559
10 SASI_Rn02_00262538 predicted 556
11 SASI_Rn01_00078153 predicted 224
12 SASI_Rn01_00078154 predicted 205
13 SASI_Rn01_00078155 predicted 223
14 SASI_Rn01_00078156 predicted 214
15 SASI_Rn01_00078157 predicted 222
16 SASI_Rn01_00078158 predicted 196
17 SASI_Rn01_00078159 predicted 198
18 SASI_Rn01_00078160 predicted 129
19 SASI_Rn01_00078161 predicted 35
20 SASI_Rn01_00078162 predicted 23
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307638 predicted 516
2 SASI_Mm02_00307639 predicted 573
3 SASI_Mm02_00307640 predicted 584
4 SASI_Mm02_00307641 predicted 573
5 SASI_Mm02_00307642 predicted 330
6 SASI_Mm02_00307643 predicted 400
7 SASI_Mm02_00307644 predicted 524
8 SASI_Mm02_00307645 predicted 412
9 SASI_Mm02_00307646 predicted 349
10 SASI_Mm02_00307647 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037073 predicted 696
2 SASI_Mm01_00037080 predicted 745
3 SASI_Mm01_00037081 predicted 766
4 SASI_Mm02_00325811 predicted 753
5 SASI_Mm01_00037082 predicted 510
6 SASI_Mm02_00325812 predicted 766
7 SASI_Mm02_00325813 predicted 495
8 SASI_Mm02_00325814 predicted 570
9 SASI_Mm02_00325815 predicted 703
10 SASI_Mm02_00325816 predicted 584
11 SASI_Mm01_00037074 predicted 457
12 SASI_Mm01_00037075 predicted 307
13 SASI_Mm01_00037076 predicted 303
14 SASI_Mm01_00037077 predicted 374
15 SASI_Mm01_00037078 predicted 228
16 SASI_Mm01_00037079 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_079420
MYL1 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 1, alkali; skeletal, fast
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-481s1c1
Sequence:CCGGGCAAGCCATTTCCAACAACAACTCGAGTTGTTGTTGGAAATGGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-399s1c1
Sequence:CCGGAGGTCAGGAAAGTTCTGGGAACTCGAGTTCCCAGAACTTTCCTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-255s1c1
Sequence:CCGGCCATTAAGATCGAGTTCTCTACTCGAGTAGAGAACTCGATCTTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-509s1c1
Sequence:CCGGGCCACCTATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-457s1c1
Sequence:CCGGGTTTGAACAATTTCTGCCTATCTCGAGATAGGCAGAAATTGTTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079420.2-707s21c1
Sequence:CCGGCTATCTGAATGGAGCTCTCAACTCGAGTTGAGAGCTCCATTCAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079420.2-327s21c1
Sequence:CCGGTGATTCCAAGATCACCTTAAGCTCGAGCTTAAGGTGATCTTGGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_079420.2-792s21c1
Sequence:CCGGCAGATCTGTTTACCATCATTCCTCGAGGAATGATGGTAAACAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_079420
MYL1 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 1, alkali; skeletal, fast
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-481s1c1
Sequence:CCGGGCAAGCCATTTCCAACAACAACTCGAGTTGTTGTTGGAAATGGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-399s1c1
Sequence:CCGGAGGTCAGGAAAGTTCTGGGAACTCGAGTTCCCAGAACTTTCCTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-255s1c1
Sequence:CCGGCCATTAAGATCGAGTTCTCTACTCGAGTAGAGAACTCGATCTTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-509s1c1
Sequence:CCGGGCCACCTATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-457s1c1
Sequence:CCGGGTTTGAACAATTTCTGCCTATCTCGAGATAGGCAGAAATTGTTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079420.2-707s21c1
Sequence:CCGGCTATCTGAATGGAGCTCTCAACTCGAGTTGAGAGCTCCATTCAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079420.2-327s21c1
Sequence:CCGGTGATTCCAAGATCACCTTAAGCTCGAGCTTAAGGTGATCTTGGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_079420.2-792s21c1
Sequence:CCGGCAGATCTGTTTACCATCATTCCTCGAGGAATGATGGTAAACAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_079420
MYL1 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 1, alkali; skeletal, fast
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-481s1c1
Sequence:CCGGGCAAGCCATTTCCAACAACAACTCGAGTTGTTGTTGGAAATGGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-399s1c1
Sequence:CCGGAGGTCAGGAAAGTTCTGGGAACTCGAGTTCCCAGAACTTTCCTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-255s1c1
Sequence:CCGGCCATTAAGATCGAGTTCTCTACTCGAGTAGAGAACTCGATCTTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-509s1c1
Sequence:CCGGGCCACCTATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079420.1-457s1c1
Sequence:CCGGGTTTGAACAATTTCTGCCTATCTCGAGATAGGCAGAAATTGTTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079420.2-707s21c1
Sequence:CCGGCTATCTGAATGGAGCTCTCAACTCGAGTTGAGAGCTCCATTCAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079420.2-327s21c1
Sequence:CCGGTGATTCCAAGATCACCTTAAGCTCGAGCTTAAGGTGATCTTGGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_079420.2-792s21c1
Sequence:CCGGCAGATCTGTTTACCATCATTCCTCGAGGAATGATGGTAAACAGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021285
MYL1 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 1, alkali; skeletal, fast
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021285.1-777s1c1
Sequence:CCGGCCATGCAGAAGATCAAACAATCTCGAGATTGTTTGATCTTCTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-401s1c1
Sequence:CCGGCCCAGCAATGAAGAGATGAATCTCGAGATTCATCTCTTCATTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-229s1c1
Sequence:CCGGGTCTGCTATTAAGATCGAGTTCTCGAGAACTCGATCTTAATAGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-409s1c1
Sequence:CCGGTGAAGAGATGAATGCTAAGAACTCGAGTTCTTAGCATTCATCTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-460s1c1
Sequence:CCGGGCAAGCTATCTCCAACAACAACTCGAGTTGTTGTTGGAGATAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021285
MYL1 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 1, alkali; skeletal, fast
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021285.1-777s1c1
Sequence:CCGGCCATGCAGAAGATCAAACAATCTCGAGATTGTTTGATCTTCTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-401s1c1
Sequence:CCGGCCCAGCAATGAAGAGATGAATCTCGAGATTCATCTCTTCATTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-229s1c1
Sequence:CCGGGTCTGCTATTAAGATCGAGTTCTCGAGAACTCGATCTTAATAGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-409s1c1
Sequence:CCGGTGAAGAGATGAATGCTAAGAACTCGAGTTCTTAGCATTCATCTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-460s1c1
Sequence:CCGGGCAAGCTATCTCCAACAACAACTCGAGTTGTTGTTGGAGATAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021285
MYL1 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 1, alkali; skeletal, fast
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021285.1-777s1c1
Sequence:CCGGCCATGCAGAAGATCAAACAATCTCGAGATTGTTTGATCTTCTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-401s1c1
Sequence:CCGGCCCAGCAATGAAGAGATGAATCTCGAGATTCATCTCTTCATTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-229s1c1
Sequence:CCGGGTCTGCTATTAAGATCGAGTTCTCGAGAACTCGATCTTAATAGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-409s1c1
Sequence:CCGGTGAAGAGATGAATGCTAAGAACTCGAGTTCTTAGCATTCATCTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021285.1-460s1c1
Sequence:CCGGGCAAGCTATCTCCAACAACAACTCGAGTTGTTGTTGGAGATAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)