EMAIL THIS PAGE TO A FRIEND

MYL2

myosin, light chain 2, regulatory, cardiac, slow

58 Gene Product Result for
Synonyms: CMH10 MLC2
UniProtKB ID: P10916, Q16123
Gene ID:
Human(4633) Summary: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Mouse(17906) myosin, light polypeptide 2, regulatory, cardiac, slow
Rat(363925) myosin, light chain 2, regulatory, cardiac, slow
chicken(416874) myosin, light chain 2, regulatory, cardiac, slow
dog(403614) myosin, light chain 2, regulatory, cardiac, slow
cow(505519) myosin, light chain 2, regulatory, cardiac, slow
domestic cat(101101169) myosin, light chain 2, regulatory, cardiac, slow
sheep(100196904) myosin, light chain 2, regulatory, cardiac, slow
naked mole-rat(101713909) myosin, light chain 2, regulatory, cardiac, slow
domestic guinea pig(100719658) myosin, light chain 2, regulatory, cardiac, slow
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0734 AQUA Peptide EAFTIMDQN[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000432 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000432 Rosetta Predictions human pricing
NM_001035252 Rosetta Predictions rat pricing
NM_010861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205875 predicted 482
2 SASI_Hs01_00205876 predicted 389
3 SASI_Hs01_00205877 predicted 384
4 SASI_Hs01_00205878 predicted 353
5 SASI_Hs01_00205879 predicted 325
6 SASI_Hs01_00205880 predicted 336
7 SASI_Hs01_00205881 predicted 479
8 SASI_Hs01_00205882 predicted 391
9 SASI_Hs01_00205883 predicted 268
10 SASI_Hs01_00205884 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115133 predicted 381
2 SASI_Rn01_00115134 predicted 317
3 SASI_Rn01_00115135 predicted 249
4 SASI_Rn02_00204207 predicted 383
5 SASI_Rn01_00115137 predicted 286
6 SASI_Rn01_00115138 predicted 204
7 SASI_Rn01_00115141 predicted 255
8 SASI_Rn02_00204208 predicted 206
9 SASI_Rn01_00115142 predicted 267
10 SASI_Rn02_00204209 predicted 378
11 SASI_Rn01_00115136 predicted 227
12 SASI_Rn01_00115139 predicted 395
13 SASI_Rn01_00115140 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125157 predicted 386
2 SASI_Mm01_00125158 predicted 356
3 SASI_Mm01_00125159 predicted 378
4 SASI_Mm01_00125162 predicted 389
5 SASI_Mm01_00125163 predicted 335
6 SASI_Mm01_00125164 predicted 285
7 SASI_Mm01_00125165 predicted 208
8 SASI_Mm01_00125166 predicted 285
9 SASI_Mm02_00319516 predicted 339
10 SASI_Mm02_00319517 predicted 347
11 SASI_Mm01_00125160 predicted 245
12 SASI_Mm01_00125161 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010861
MYL2 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 2, regulatory, cardiac, slow
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010861.2-605s1c1
Sequence:CCGGCGCAAATAAACAGGAAGTCTTCTCGAGAAGACTTCCTGTTTATTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-339s1c1
Sequence:CCGGGACCATTCTCAACGCATTCAACTCGAGTTGAATGCGTTGAGAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-214s1c1
Sequence:CCGGCTAGGACGAGTGAACGTGAAACTCGAGTTTCACGTTCACTCGTCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-489s1c1
Sequence:CCGGCGGCAATCTTGATTATAAGAACTCGAGTTCTTATAATCAAGATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-382s21c1
Sequence:CCGGGGTCACTGAAGGCTGACTATGCTCGAGCATAGTCAGCCTTCAGTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-134s21c1
Sequence:CCGGCAAGGAAGCCTTCACAATCATCTCGAGATGATTGTGAAGGCTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-241s21c1
Sequence:CCGGAGATCGATGAAATGATCAAAGCTCGAGCTTTGATCATTTCATCGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-273s1c1
Sequence:CCGGTCCAATTAACTTCACCGTGTTCTCGAGAACACGGTGAAGTTAATTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-419s21c1
Sequence:CCGGCACACAAGCAGAGAGGTTCTCCTCGAGGAGAACCTCTCTGCTTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010861
MYL2 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 2, regulatory, cardiac, slow
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010861.2-605s1c1
Sequence:CCGGCGCAAATAAACAGGAAGTCTTCTCGAGAAGACTTCCTGTTTATTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-339s1c1
Sequence:CCGGGACCATTCTCAACGCATTCAACTCGAGTTGAATGCGTTGAGAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-214s1c1
Sequence:CCGGCTAGGACGAGTGAACGTGAAACTCGAGTTTCACGTTCACTCGTCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-489s1c1
Sequence:CCGGCGGCAATCTTGATTATAAGAACTCGAGTTCTTATAATCAAGATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-382s21c1
Sequence:CCGGGGTCACTGAAGGCTGACTATGCTCGAGCATAGTCAGCCTTCAGTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-134s21c1
Sequence:CCGGCAAGGAAGCCTTCACAATCATCTCGAGATGATTGTGAAGGCTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-241s21c1
Sequence:CCGGAGATCGATGAAATGATCAAAGCTCGAGCTTTGATCATTTCATCGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-273s1c1
Sequence:CCGGTCCAATTAACTTCACCGTGTTCTCGAGAACACGGTGAAGTTAATTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-419s21c1
Sequence:CCGGCACACAAGCAGAGAGGTTCTCCTCGAGGAGAACCTCTCTGCTTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010861
MYL2 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 2, regulatory, cardiac, slow
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010861.2-605s1c1
Sequence:CCGGCGCAAATAAACAGGAAGTCTTCTCGAGAAGACTTCCTGTTTATTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-339s1c1
Sequence:CCGGGACCATTCTCAACGCATTCAACTCGAGTTGAATGCGTTGAGAATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-214s1c1
Sequence:CCGGCTAGGACGAGTGAACGTGAAACTCGAGTTTCACGTTCACTCGTCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-489s1c1
Sequence:CCGGCGGCAATCTTGATTATAAGAACTCGAGTTCTTATAATCAAGATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-382s21c1
Sequence:CCGGGGTCACTGAAGGCTGACTATGCTCGAGCATAGTCAGCCTTCAGTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-134s21c1
Sequence:CCGGCAAGGAAGCCTTCACAATCATCTCGAGATGATTGTGAAGGCTTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-241s21c1
Sequence:CCGGAGATCGATGAAATGATCAAAGCTCGAGCTTTGATCATTTCATCGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010861.2-273s1c1
Sequence:CCGGTCCAATTAACTTCACCGTGTTCTCGAGAACACGGTGAAGTTAATTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010861.3-419s21c1
Sequence:CCGGCACACAAGCAGAGAGGTTCTCCTCGAGGAGAACCTCTCTGCTTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000432
MYL2 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 2, regulatory, cardiac, slow
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-97s1c1
Sequence:CCGGCAGACCCAAATCCAGGAATTTCTCGAGAAATTCCTGGATTTGGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-264s1c1
Sequence:CCGGCTTTACTGTGTTCCTCTCAATCTCGAGATTGAGAGGAACACAGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-459s1c1
Sequence:CCGGCCCTGACGTGACTGGAAACTTCTCGAGAAGTTTCCAGTCACGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-328s1c1
Sequence:CCGGCTCAACGCATTCAAAGTGTTTCTCGAGAAACACTTTGAATGCGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-312s1c1
Sequence:CCGGCCCTGAGGAAACCATTCTCAACTCGAGTTGAGAATGGTTTCCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-289s21c1
Sequence:CCGGCTCCGGGTCCAATTAACTTTACTCGAGTAAAGTTAATTGGACCCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-416s21c1
Sequence:CCGGGGCTGATTACGTTCGGGAAATCTCGAGATTTCCCGAACGTAATCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-211s21c1
Sequence:CCGGACGATCTGAGAGACACCTTTGCTCGAGCAAAGGTGTCTCTCAGATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000432
MYL2 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 2, regulatory, cardiac, slow
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-97s1c1
Sequence:CCGGCAGACCCAAATCCAGGAATTTCTCGAGAAATTCCTGGATTTGGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-264s1c1
Sequence:CCGGCTTTACTGTGTTCCTCTCAATCTCGAGATTGAGAGGAACACAGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-459s1c1
Sequence:CCGGCCCTGACGTGACTGGAAACTTCTCGAGAAGTTTCCAGTCACGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-328s1c1
Sequence:CCGGCTCAACGCATTCAAAGTGTTTCTCGAGAAACACTTTGAATGCGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-312s1c1
Sequence:CCGGCCCTGAGGAAACCATTCTCAACTCGAGTTGAGAATGGTTTCCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-289s21c1
Sequence:CCGGCTCCGGGTCCAATTAACTTTACTCGAGTAAAGTTAATTGGACCCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-416s21c1
Sequence:CCGGGGCTGATTACGTTCGGGAAATCTCGAGATTTCCCGAACGTAATCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-211s21c1
Sequence:CCGGACGATCTGAGAGACACCTTTGCTCGAGCAAAGGTGTCTCTCAGATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000432
MYL2 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 2, regulatory, cardiac, slow
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-97s1c1
Sequence:CCGGCAGACCCAAATCCAGGAATTTCTCGAGAAATTCCTGGATTTGGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-264s1c1
Sequence:CCGGCTTTACTGTGTTCCTCTCAATCTCGAGATTGAGAGGAACACAGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-459s1c1
Sequence:CCGGCCCTGACGTGACTGGAAACTTCTCGAGAAGTTTCCAGTCACGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-328s1c1
Sequence:CCGGCTCAACGCATTCAAAGTGTTTCTCGAGAAACACTTTGAATGCGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000432.1-312s1c1
Sequence:CCGGCCCTGAGGAAACCATTCTCAACTCGAGTTGAGAATGGTTTCCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-289s21c1
Sequence:CCGGCTCCGGGTCCAATTAACTTTACTCGAGTAAAGTTAATTGGACCCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-416s21c1
Sequence:CCGGGGCTGATTACGTTCGGGAAATCTCGAGATTTCCCGAACGTAATCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000432.3-211s21c1
Sequence:CCGGACGATCTGAGAGACACCTTTGCTCGAGCAAAGGTGTCTCTCAGATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)