EMAIL THIS PAGE TO A FRIEND

MYL3

myosin, light chain 3, alkali; ventricular, skeletal, slow

60 Gene Product Result for
Synonyms: CMH8 MLC1SB MLC1V VLC1
UniProtKB ID: P08590, B2R534, Q9NRS8
Gene ID:
Human(4634) Summary: MYL3 encodes myosin light chain 3, an alkali light chain also referred to in the literature as both the ventricular isoform and the slow skeletal muscle isoform. Mutations in MYL3 have been identified as a cause of mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Mouse(17897) myosin, light polypeptide 3
Rat(24585) myosin, light chain 3, alkali; ventricular, skeletal, slow
chicken(396067) myosin, light chain 3, alkali; ventricular, skeletal, slow
cow(618352) myosin, light chain 3, alkali; ventricular, skeletal, slow
domestic cat(101084780) myosin, light chain 3, alkali; ventricular, skeletal, slow
dog(476644) myosin, light chain 3, alkali; ventricular, skeletal, slow
domestic guinea pig(100718060) myosin, light chain 3, alkali; ventricular, skeletal, slow
naked mole-rat(101716754) myosin, light chain 3, alkali; ventricular, skeletal, slow
sheep(101115408) myosin, light chain 3, alkali; ventricular, skeletal, slow
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000258 Rosetta Predictions human pricing
NM_012606 Rosetta Predictions rat pricing
NM_010859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043033 predicted 379
2 SASI_Hs02_00302194 predicted 222
3 SASI_Hs02_00302195 predicted 203
4 SASI_Hs01_00043035 predicted 635
5 SASI_Hs02_00302196 predicted 223
6 SASI_Hs01_00043036 predicted 283
7 SASI_Hs02_00302197 predicted 217
8 SASI_Hs01_00043039 predicted 433
9 SASI_Hs01_00043040 predicted 600
10 SASI_Hs01_00043041 predicted 268
11 SASI_Hs01_00043032 predicted 246
12 SASI_Hs01_00043034 predicted 527
13 SASI_Hs01_00043037 predicted 629
14 SASI_Hs01_00043038 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118444 predicted 260
2 SASI_Rn01_00118445 predicted 235
3 SASI_Rn01_00118446 predicted 248
4 SASI_Rn02_00259783 predicted 197
5 SASI_Rn01_00118447 predicted 553
6 SASI_Rn01_00118448 predicted 570
7 SASI_Rn01_00118449 predicted 492
8 SASI_Rn01_00118450 predicted 355
9 SASI_Rn02_00259784 predicted 436
10 SASI_Rn01_00118451 predicted 522
11 SASI_Rn01_00118452 predicted 621
12 SASI_Rn01_00118453 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116738 predicted 202
2 SASI_Mm01_00116739 predicted 219
3 SASI_Mm01_00116740 predicted 214
4 SASI_Mm01_00116741 predicted 392
5 SASI_Mm01_00116742 predicted 284
6 SASI_Mm02_00319515 predicted 672
7 SASI_Mm01_00116743 predicted 649
8 SASI_Mm01_00116744 predicted 428
9 SASI_Mm01_00116745 predicted 215
10 SASI_Mm01_00116746 predicted 388
11 SASI_Mm01_00116737 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000258
MYL3 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 3, alkali; ventricular, skeletal, slow
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000258.2-637s21c1
Sequence:CCGGTGCATCAACTATGAAGCATTTCTCGAGAAATGCTTCATAGTTGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-239s1c1
Sequence:CCGGCACACCCAAGTGTGAGATGAACTCGAGTTCATCTCACACTTGGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-141s1c1
Sequence:CCGGCGCCCTAAGGAGGTCGAGTTTCTCGAGAAACTCGACCTCCTTAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-407s1c1
Sequence:CCGGGCACATTTCCAAGAACAAGGACTCGAGTCCTTGTTCTTGGAAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-362s1c1
Sequence:CCGGCAATACCAAGATGATGGACTTCTCGAGAAGTCCATCATCTTGGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000258.2-208s21c1
Sequence:CCGGGCTTCCAAGATCAAGATTGAGCTCGAGCTCAATCTTGATCTTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000258
MYL3 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 3, alkali; ventricular, skeletal, slow
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000258.2-637s21c1
Sequence:CCGGTGCATCAACTATGAAGCATTTCTCGAGAAATGCTTCATAGTTGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-239s1c1
Sequence:CCGGCACACCCAAGTGTGAGATGAACTCGAGTTCATCTCACACTTGGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-141s1c1
Sequence:CCGGCGCCCTAAGGAGGTCGAGTTTCTCGAGAAACTCGACCTCCTTAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-407s1c1
Sequence:CCGGGCACATTTCCAAGAACAAGGACTCGAGTCCTTGTTCTTGGAAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-362s1c1
Sequence:CCGGCAATACCAAGATGATGGACTTCTCGAGAAGTCCATCATCTTGGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000258.2-208s21c1
Sequence:CCGGGCTTCCAAGATCAAGATTGAGCTCGAGCTCAATCTTGATCTTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000258
MYL3 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 3, alkali; ventricular, skeletal, slow
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000258.2-637s21c1
Sequence:CCGGTGCATCAACTATGAAGCATTTCTCGAGAAATGCTTCATAGTTGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-239s1c1
Sequence:CCGGCACACCCAAGTGTGAGATGAACTCGAGTTCATCTCACACTTGGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-141s1c1
Sequence:CCGGCGCCCTAAGGAGGTCGAGTTTCTCGAGAAACTCGACCTCCTTAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-407s1c1
Sequence:CCGGGCACATTTCCAAGAACAAGGACTCGAGTCCTTGTTCTTGGAAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000258.1-362s1c1
Sequence:CCGGCAATACCAAGATGATGGACTTCTCGAGAAGTCCATCATCTTGGTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000258.2-208s21c1
Sequence:CCGGGCTTCCAAGATCAAGATTGAGCTCGAGCTCAATCTTGATCTTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010859
MYL3 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 3, alkali; ventricular, skeletal, slow
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-210s1c1
Sequence:CCGGCTCCAAGATTAAGATCGAGTTCTCGAGAACTCGATCTTAATCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-601s1c1
Sequence:CCGGGAGAAACTGATGGCTGGTCAACTCGAGTTGACCAGCCATCAGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010859.1-718s1c1
Sequence:CCGGCAACCATGATGCTGACACCATCTCGAGATGGTGTCAGCATCATGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-204s1c1
Sequence:CCGGTGATGCCTCCAAGATTAAGATCTCGAGATCTTAATCTTGGAGGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-405s1c1
Sequence:CCGGCAATTCCAAGATGATGGATTTCTCGAGAAATCCATCATCTTGGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010859
MYL3 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 3, alkali; ventricular, skeletal, slow
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-210s1c1
Sequence:CCGGCTCCAAGATTAAGATCGAGTTCTCGAGAACTCGATCTTAATCTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-601s1c1
Sequence:CCGGGAGAAACTGATGGCTGGTCAACTCGAGTTGACCAGCCATCAGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010859.1-718s1c1
Sequence:CCGGCAACCATGATGCTGACACCATCTCGAGATGGTGTCAGCATCATGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-204s1c1
Sequence:CCGGTGATGCCTCCAAGATTAAGATCTCGAGATCTTAATCTTGGAGGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-405s1c1
Sequence:CCGGCAATTCCAAGATGATGGATTTCTCGAGAAATCCATCATCTTGGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010859
MYL3 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 3, alkali; ventricular, skeletal, slow
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-210s1c1
Sequence:CCGGCTCCAAGATTAAGATCGAGTTCTCGAGAACTCGATCTTAATCTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-601s1c1
Sequence:CCGGGAGAAACTGATGGCTGGTCAACTCGAGTTGACCAGCCATCAGTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010859.1-718s1c1
Sequence:CCGGCAACCATGATGCTGACACCATCTCGAGATGGTGTCAGCATCATGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-204s1c1
Sequence:CCGGTGATGCCTCCAAGATTAAGATCTCGAGATCTTAATCTTGGAGGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010859.1-405s1c1
Sequence:CCGGCAATTCCAAGATGATGGATTTCTCGAGAAATCCATCATCTTGGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)