EMAIL THIS PAGE TO A FRIEND

MYL5

myosin, light chain 5, regulatory

20 Gene Product Result for
UniProtKB ID: Q02045, Q8IXL8
Gene ID:
Human(4636) Summary: This gene encodes one of the myosin light chains, a component of the hexameric ATPase cellular motor protein myosin. Myosin is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene product, one of the regulatory light chains, is expressed in fetal muscle and in adult retina, cerebellum, and basal ganglia. [provided by RefSeq, Jul 2008]
dog(479135) myosin, light chain 5, regulatory
cow(101907739) myosin, light chain 5, regulatory
domestic cat(493974) myosin, light chain 5, regulatory
naked mole-rat(101722418) myosin, light chain 5, regulatory
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002477 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171180 predicted 401
2 SASI_Hs01_00171181 predicted 401
3 SASI_Hs01_00171182 predicted 277
4 SASI_Hs01_00171184 predicted 402
5 SASI_Hs01_00171185 predicted 195
6 SASI_Hs01_00171186 predicted 286
7 SASI_Hs01_00171187 predicted 206
8 SASI_Hs01_00171188 predicted 261
9 SASI_Hs01_00171189 predicted 393
10 SASI_Hs02_00333905 predicted 400
11 SASI_Hs01_00171183 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002477
VALIDATED
MYL5 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 5, regulatory
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002477.1-289s21c1
Sequence:CCGGCTGGGCAAGACCAACGTCAAGCTCGAGCTTGACGTTGGTCTTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-263s21c1
Sequence:CCGGAGGACCTGAAGGACACCTATGCTCGAGCATAGGTGTCCTTCAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-156s21c1
Sequence:CCGGGAGAGCCTCATCCAATGTCTTCTCGAGAAGACATTGGATGAGGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-226s1c1
Sequence:CCGGCTCATGGATCAGAACCGAGATCTCGAGATCTCGGTTCTGATCCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-349s1c1
Sequence:CCGGCCCATCAACTTCACCATGTTTCTCGAGAAACATGGTGAAGTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002477.1-417s1c1
Sequence:CCGGCATTCTTAACGCCTTCAAGATCTCGAGATCTTGAAGGCGTTAAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-502s1c1
Sequence:CCGGGCTGACAAGATGACGGCGGAACTCGAGTTCCGCCGTCATCTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-178s21c1
Sequence:CCGGTCCAACTTTGAGCAGACTCAGCTCGAGCTGAGTCTGCTCAAAGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-463s21c1
Sequence:CCGGATCAACAAGGAGTACATCAAGCTCGAGCTTGATGTACTCCTTGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002477
VALIDATED
MYL5 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 5, regulatory
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002477.1-289s21c1
Sequence:CCGGCTGGGCAAGACCAACGTCAAGCTCGAGCTTGACGTTGGTCTTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-263s21c1
Sequence:CCGGAGGACCTGAAGGACACCTATGCTCGAGCATAGGTGTCCTTCAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-156s21c1
Sequence:CCGGGAGAGCCTCATCCAATGTCTTCTCGAGAAGACATTGGATGAGGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-226s1c1
Sequence:CCGGCTCATGGATCAGAACCGAGATCTCGAGATCTCGGTTCTGATCCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-349s1c1
Sequence:CCGGCCCATCAACTTCACCATGTTTCTCGAGAAACATGGTGAAGTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002477.1-417s1c1
Sequence:CCGGCATTCTTAACGCCTTCAAGATCTCGAGATCTTGAAGGCGTTAAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-502s1c1
Sequence:CCGGGCTGACAAGATGACGGCGGAACTCGAGTTCCGCCGTCATCTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-178s21c1
Sequence:CCGGTCCAACTTTGAGCAGACTCAGCTCGAGCTGAGTCTGCTCAAAGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-463s21c1
Sequence:CCGGATCAACAAGGAGTACATCAAGCTCGAGCTTGATGTACTCCTTGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002477
VALIDATED
MYL5 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 5, regulatory
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002477.1-289s21c1
Sequence:CCGGCTGGGCAAGACCAACGTCAAGCTCGAGCTTGACGTTGGTCTTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-263s21c1
Sequence:CCGGAGGACCTGAAGGACACCTATGCTCGAGCATAGGTGTCCTTCAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-156s21c1
Sequence:CCGGGAGAGCCTCATCCAATGTCTTCTCGAGAAGACATTGGATGAGGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-226s1c1
Sequence:CCGGCTCATGGATCAGAACCGAGATCTCGAGATCTCGGTTCTGATCCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-349s1c1
Sequence:CCGGCCCATCAACTTCACCATGTTTCTCGAGAAACATGGTGAAGTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002477.1-417s1c1
Sequence:CCGGCATTCTTAACGCCTTCAAGATCTCGAGATCTTGAAGGCGTTAAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002477.1-502s1c1
Sequence:CCGGGCTGACAAGATGACGGCGGAACTCGAGTTCCGCCGTCATCTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-178s21c1
Sequence:CCGGTCCAACTTTGAGCAGACTCAGCTCGAGCTGAGTCTGCTCAAAGTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002477.1-463s21c1
Sequence:CCGGATCAACAAGGAGTACATCAAGCTCGAGCTTGATGTACTCCTTGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)