EMAIL THIS PAGE TO A FRIEND

MYL6

myosin, light chain 6, alkali, smooth muscle and non-muscle

129 Gene Product Result for
Synonyms: ESMLC LC17 LC17-GI LC17-NM LC17A LC17B MLC-3 MLC1SM MLC3NM MLC3SM
Gene ID:
Human(4637) Summary: Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain that is expressed in smooth muscle and non-muscle tissues. Genomic sequences representing several pseudogenes have been described and two transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(17904) myosin, light polypeptide 6, alkali, smooth muscle and non-muscle
Rat(685867) myosin, light chain 6, alkali, smooth muscle and non-muscle
naked mole-rat(101716332) myosin, light chain 6, alkali, smooth muscle and non-muscle
domestic guinea pig(100735026) myosin, light chain 6, alkali, smooth muscle and non-muscle
sheep(100135445) myosin, light chain 6, alkali, smooth muscle and non-muscle
Zebrafish(798632) myosin, light chain 6, alkali, smooth muscle and non-muscle
dog(607030) myosin, light chain 6, alkali, smooth muscle and non-muscle
cow(281341) myosin, light chain 6, alkali, smooth muscle and non-muscle
domestic cat(101096244) myosin, light chain 6, alkali, smooth muscle and non-muscle
chicken(100996929) myosin, light chain 6, alkali, smooth muscle and non-muscle
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021019 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125741 MISSION® esiRNA esiRNA human MYL6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021019 Rosetta Predictions human pricing
NM_079423 Rosetta Predictions human pricing
NM_001109484 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354489 predicted 271
2 SASI_Hs02_00354490 predicted 271
3 SASI_Hs02_00354491 predicted 264
4 SASI_Hs02_00354492 predicted 253
5 SASI_Hs02_00354493 predicted 259
6 SASI_Hs02_00354494 predicted 277
7 SASI_Hs02_00354495 predicted 251
8 SASI_Hs02_00354496 predicted 262
9 SASI_Hs02_00354497 predicted 279
10 SASI_Hs01_00015688 predicted 685
11 SASI_Hs01_00015687 predicted 655
12 SASI_Hs01_00015689 predicted 344
13 SASI_Hs01_00015690 predicted 612
14 SASI_Hs01_00015691 predicted 710
15 SASI_Hs01_00015692 predicted 389
16 SASI_Hs01_00015693 predicted 339
17 SASI_Hs01_00015694 predicted 616
18 SASI_Hs01_00015695 predicted 690
19 SASI_Hs01_00015696 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_079423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362192 predicted 273
2 SASI_Hs02_00362193 predicted 272
3 SASI_Hs02_00362194 predicted 272
4 SASI_Hs02_00362195 predicted 245
5 SASI_Hs02_00362196 predicted 252
6 SASI_Hs02_00362197 predicted 273
7 SASI_Hs02_00362198 predicted 246
8 SASI_Hs02_00362199 predicted 266
9 SASI_Hs02_00362200 predicted 284
10 SASI_Hs01_00016198 predicted 643
11 SASI_Hs01_00016197 predicted 610
12 SASI_Hs01_00016199 predicted 343
13 SASI_Hs01_00016200 predicted 575
14 SASI_Hs01_00016201 predicted 673
15 SASI_Hs01_00016202 predicted 398
16 SASI_Hs01_00016203 predicted 334
17 SASI_Hs01_00016204 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248849 predicted 313
2 SASI_Rn02_00248850 predicted 340
3 SASI_Rn02_00248851 predicted 386
4 SASI_Rn02_00248852 predicted 361
5 SASI_Rn02_00248853 predicted 231
6 SASI_Rn02_00248854 predicted 233
7 SASI_Rn02_00248855 predicted 337
8 SASI_Rn02_00248856 predicted 320
9 SASI_Rn02_00248857 predicted 320
10 SASI_Rn02_00248858 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010860
VALIDATED
MYL6 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 6, alkali, smooth muscle and non-muscle
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010860.2-294s1c1
Sequence:CCGGCGTGTGTTTGACAAGGAAGGACTCGAGTCCTTCCTTGTCAAACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-378s1c1
Sequence:CCGGGAGGAAGAAGTAGAGATGCTACTCGAGTAGCATCTCTACTTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-416s1c1
Sequence:CCGGCAGCAATGGTTGCATCAACTACTCGAGTAGTTGATGCAACCATTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-426s1c1
Sequence:CCGGTGCATCAACTATGAAGAGCTTCTCGAGAAGCTCTTCATAGTTGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010860.2-319s1c1
Sequence:CCGGGCACCGTCATGGGTGCTGAAACTCGAGTTTCAGCACCCATGACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-294s21c1
Sequence:CCGGCGTGTGTTTGACAAGGAAGGACTCGAGTCCTTCCTTGTCAAACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-473s21c1
Sequence:CCGGACATTCTGTATCCCGAGTCTGCTCGAGCAGACTCGGGATACAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010860.3-416s21c1
Sequence:CCGGCAGCAATGGTTGCATCAACTACTCGAGTAGTTGATGCAACCATTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-378s21c1
Sequence:CCGGGAGGAAGAAGTAGAGATGCTACTCGAGTAGCATCTCTACTTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-262s21c1
Sequence:CCGGAGGGAACCTACGAGGATTATGCTCGAGCATAATCCTCGTAGGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010860
VALIDATED
MYL6 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 6, alkali, smooth muscle and non-muscle
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010860.2-294s1c1
Sequence:CCGGCGTGTGTTTGACAAGGAAGGACTCGAGTCCTTCCTTGTCAAACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-378s1c1
Sequence:CCGGGAGGAAGAAGTAGAGATGCTACTCGAGTAGCATCTCTACTTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-416s1c1
Sequence:CCGGCAGCAATGGTTGCATCAACTACTCGAGTAGTTGATGCAACCATTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-426s1c1
Sequence:CCGGTGCATCAACTATGAAGAGCTTCTCGAGAAGCTCTTCATAGTTGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010860.2-319s1c1
Sequence:CCGGGCACCGTCATGGGTGCTGAAACTCGAGTTTCAGCACCCATGACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-294s21c1
Sequence:CCGGCGTGTGTTTGACAAGGAAGGACTCGAGTCCTTCCTTGTCAAACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-473s21c1
Sequence:CCGGACATTCTGTATCCCGAGTCTGCTCGAGCAGACTCGGGATACAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010860.3-416s21c1
Sequence:CCGGCAGCAATGGTTGCATCAACTACTCGAGTAGTTGATGCAACCATTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-378s21c1
Sequence:CCGGGAGGAAGAAGTAGAGATGCTACTCGAGTAGCATCTCTACTTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-262s21c1
Sequence:CCGGAGGGAACCTACGAGGATTATGCTCGAGCATAATCCTCGTAGGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010860
VALIDATED
MYL6 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 6, alkali, smooth muscle and non-muscle
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010860.2-294s1c1
Sequence:CCGGCGTGTGTTTGACAAGGAAGGACTCGAGTCCTTCCTTGTCAAACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-378s1c1
Sequence:CCGGGAGGAAGAAGTAGAGATGCTACTCGAGTAGCATCTCTACTTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-416s1c1
Sequence:CCGGCAGCAATGGTTGCATCAACTACTCGAGTAGTTGATGCAACCATTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010860.2-426s1c1
Sequence:CCGGTGCATCAACTATGAAGAGCTTCTCGAGAAGCTCTTCATAGTTGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010860.2-319s1c1
Sequence:CCGGGCACCGTCATGGGTGCTGAAACTCGAGTTTCAGCACCCATGACGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-294s21c1
Sequence:CCGGCGTGTGTTTGACAAGGAAGGACTCGAGTCCTTCCTTGTCAAACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-473s21c1
Sequence:CCGGACATTCTGTATCCCGAGTCTGCTCGAGCAGACTCGGGATACAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010860.3-416s21c1
Sequence:CCGGCAGCAATGGTTGCATCAACTACTCGAGTAGTTGATGCAACCATTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-378s21c1
Sequence:CCGGGAGGAAGAAGTAGAGATGCTACTCGAGTAGCATCTCTACTTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010860.3-262s21c1
Sequence:CCGGAGGGAACCTACGAGGATTATGCTCGAGCATAATCCTCGTAGGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021019
VALIDATED
MYL6 MISSION shRNA Bacterial Glycerol Stock
myosin, light chain 6, alkali, smooth muscle and non-muscle
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-434s1c1
Sequence:CCGGCATGAGGACAGCAATGGTTGTCTCGAGACAACCATTGCTGTCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-203s1c1
Sequence:CCGGCCCAAGAGTGATGAGATGAATCTCGAGATTCATCTCATCACTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-359s1c1
Sequence:CCGGGCTGAAATCCGGCATGTTCTTCTCGAGAAGAACATGCCGGATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021019.2-293s1c1
Sequence:CCGGACCTATGAGGATTATGTCGAACTCGAGTTCGACATAATCCTCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-230s1c1
Sequence:CCGGGTGCTGGACTTTGAGCACTTTCTCGAGAAAGTGCTCAAAGTCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-562s21c1
Sequence:CCGGTCGTCCGCATGGTGCTGAATGCTCGAGCATTCAGCACCATGCGGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-405s21c1
Sequence:CCGGGCTGAAATCCGGCATGTTCTTCTCGAGAAGAACATGCCGGATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-480s21c1
Sequence:CCGGCATGAGGACAGCAATGGTTGTCTCGAGACAACCATTGCTGTCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-249s21c1
Sequence:CCGGCCCAAGAGTGATGAGATGAATCTCGAGATTCATCTCATCACTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021019
VALIDATED
MYL6 MISSION shRNA shRNA Plasmid DNA
myosin, light chain 6, alkali, smooth muscle and non-muscle
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-434s1c1
Sequence:CCGGCATGAGGACAGCAATGGTTGTCTCGAGACAACCATTGCTGTCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-203s1c1
Sequence:CCGGCCCAAGAGTGATGAGATGAATCTCGAGATTCATCTCATCACTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-359s1c1
Sequence:CCGGGCTGAAATCCGGCATGTTCTTCTCGAGAAGAACATGCCGGATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021019.2-293s1c1
Sequence:CCGGACCTATGAGGATTATGTCGAACTCGAGTTCGACATAATCCTCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-230s1c1
Sequence:CCGGGTGCTGGACTTTGAGCACTTTCTCGAGAAAGTGCTCAAAGTCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-562s21c1
Sequence:CCGGTCGTCCGCATGGTGCTGAATGCTCGAGCATTCAGCACCATGCGGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-405s21c1
Sequence:CCGGGCTGAAATCCGGCATGTTCTTCTCGAGAAGAACATGCCGGATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-480s21c1
Sequence:CCGGCATGAGGACAGCAATGGTTGTCTCGAGACAACCATTGCTGTCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-249s21c1
Sequence:CCGGCCCAAGAGTGATGAGATGAATCTCGAGATTCATCTCATCACTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021019
VALIDATED
MYL6 MISSION shRNA Lentiviral Transduction Particles
myosin, light chain 6, alkali, smooth muscle and non-muscle
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-434s1c1
Sequence:CCGGCATGAGGACAGCAATGGTTGTCTCGAGACAACCATTGCTGTCCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-203s1c1
Sequence:CCGGCCCAAGAGTGATGAGATGAATCTCGAGATTCATCTCATCACTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-359s1c1
Sequence:CCGGGCTGAAATCCGGCATGTTCTTCTCGAGAAGAACATGCCGGATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021019.2-293s1c1
Sequence:CCGGACCTATGAGGATTATGTCGAACTCGAGTTCGACATAATCCTCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021019.2-230s1c1
Sequence:CCGGGTGCTGGACTTTGAGCACTTTCTCGAGAAAGTGCTCAAAGTCCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-562s21c1
Sequence:CCGGTCGTCCGCATGGTGCTGAATGCTCGAGCATTCAGCACCATGCGGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-405s21c1
Sequence:CCGGGCTGAAATCCGGCATGTTCTTCTCGAGAAGAACATGCCGGATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-480s21c1
Sequence:CCGGCATGAGGACAGCAATGGTTGTCTCGAGACAACCATTGCTGTCCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021019.3-249s21c1
Sequence:CCGGCCCAAGAGTGATGAGATGAATCTCGAGATTCATCTCATCACTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)