EMAIL THIS PAGE TO A FRIEND

MYLIP

myosin regulatory light chain interacting protein

112 Gene Product Result for
Synonyms: IDOL MIR
UniProtKB ID: Q8WY64, Q5TIA4, Q9BU73, Q9NRL9, Q9UHE7
Gene ID:
Human(29116) Summary: The ERM protein family members ezrin, radixin, and moesin are cytoskeletal effector proteins linking actin to membrane-bound proteins at the cell surface. Myosin regulatory light chain interacting protein (MYLIP) is a novel ERM-like protein that interacts with myosin regulatory light chain and inhibits neurite outgrowth. [provided by RefSeq, Jul 2008]
Mouse(218203) myosin regulatory light chain interacting protein
Rat(306825) myosin regulatory light chain interacting protein
sheep(101102848) myosin regulatory light chain interacting protein
domestic guinea pig(100719127) myosin regulatory light chain interacting protein
naked mole-rat(101712362) myosin regulatory light chain interacting protein
chicken(420841) myosin regulatory light chain interacting protein
cow(541070) myosin regulatory light chain interacting protein
Horse(100065647) myosin regulatory light chain interacting protein
domestic cat(101093017) myosin regulatory light chain interacting protein
dog(488230) myosin regulatory light chain interacting protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101546 Anti-MYLIP antibody produced in rabbit affinity isolated antibody rat, bovine, human, canine, horse, mouse, rabbit, guinea pig
western blot pricing
SAB4501317 Anti-MYLIP antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1403211 Monoclonal Anti-MYLIP antibody produced in mouse clone 3C10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013262 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134691 MISSION® esiRNA esiRNA human MYLIP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013262 Rosetta Predictions human pricing
NM_001107344 Rosetta Predictions rat pricing
NM_153789 Rosetta Predictions mouse pricing
NM_181043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172371 predicted 1411
2 SASI_Hs01_00172372 predicted 478
3 SASI_Hs01_00172373 predicted 372
4 SASI_Hs01_00172374 predicted 367
5 SASI_Hs01_00172375 predicted 881
6 SASI_Hs01_00172377 predicted 873
7 SASI_Hs01_00172378 predicted 624
8 SASI_Hs01_00172379 predicted 337
9 SASI_Hs01_00172380 predicted 379
10 SASI_Hs02_00344483 predicted 846
11 SASI_Hs01_00172376 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227905 predicted 869
2 SASI_Rn02_00227906 predicted 319
3 SASI_Rn02_00227907 predicted 679
4 SASI_Rn02_00227908 predicted 641
5 SASI_Rn02_00227909 predicted 427
6 SASI_Rn02_00227910 predicted 1148
7 SASI_Rn02_00227911 predicted 960
8 SASI_Rn02_00227912 predicted 371
9 SASI_Rn02_00227913 predicted 1147
10 SASI_Rn02_00227914 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141549 predicted 861
2 SASI_Mm02_00343514 predicted 828
3 SASI_Mm01_00141550 predicted 415
4 SASI_Mm02_00343515 predicted 430
5 SASI_Mm02_00343516 predicted 946
6 SASI_Mm02_00343517 predicted 926
7 SASI_Mm02_00343518 predicted 1015
8 SASI_Mm02_00343519 predicted 477
9 SASI_Mm02_00343520 predicted 1215
10 SASI_Mm02_00343521 predicted 720
11 SASI_Mm01_00141551 predicted 321
12 SASI_Mm01_00141552 predicted 1399
13 SASI_Mm01_00141553 predicted 1540
14 SASI_Mm01_00141554 predicted 616
15 SASI_Mm01_00141555 predicted 1159
16 SASI_Mm01_00141556 predicted 377
17 SASI_Mm01_00141557 predicted 855
18 SASI_Mm01_00141558 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349599 predicted 647
2 SASI_Mm02_00349600 predicted 611
3 SASI_Mm02_00349601 predicted 202
4 SASI_Mm02_00349602 predicted 210
5 SASI_Mm02_00349603 predicted 733
6 SASI_Mm02_00349604 predicted 713
7 SASI_Mm02_00349605 predicted 800
8 SASI_Mm02_00349606 predicted 263
9 SASI_Mm02_00349607 predicted 994
10 SASI_Mm02_00349608 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153789
VALIDATED
MYLIP MISSION shRNA Bacterial Glycerol Stock
myosin regulatory light chain interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153789.3-1021s21c1
Sequence:CCGGCCGAAACACATGCATTCTATACTCGAGTATAGAATGCATGTGTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-318s21c1
Sequence:CCGGGGGATCATCGAGGTTGATTATCTCGAGATAATCAACCTCGATGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153789.3-854s21c1
Sequence:CCGGAGAGGACTTTAGCCCTATTAACTCGAGTTAATAGGGCTAAAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-420s21c1
Sequence:CCGGCTGGCACCTTACCGCCTTAAACTCGAGTTTAAGGCGGTAAGGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-1594s21c1
Sequence:CCGGTGCAGTATTGTAAACTATAAGCTCGAGCTTATAGTTTACAATACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153789.2-380s1c1
Sequence:CCGGGCTGAATCTGAGAAACCGGATCTCGAGATCCGGTTTCTCAGATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-1133s1c1
Sequence:CCGGCCTTGGTAAGAAATACGTCTTCTCGAGAAGACGTATTTCTTACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-866s1c1
Sequence:CCGGCCCTATTAACAGGATAGCTTACTCGAGTAAGCTATCCTGTTAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-1154s1c1
Sequence:CCGGCGACATCAAGAGAACATCCAACTCGAGTTGGATGTTCTCTTGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-509s1c1
Sequence:CCGGGCACATTAAAGAGTCCCTCTTCTCGAGAAGAGGGACTCTTTAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153789
VALIDATED
MYLIP MISSION shRNA shRNA Plasmid DNA
myosin regulatory light chain interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153789.3-1021s21c1
Sequence:CCGGCCGAAACACATGCATTCTATACTCGAGTATAGAATGCATGTGTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-318s21c1
Sequence:CCGGGGGATCATCGAGGTTGATTATCTCGAGATAATCAACCTCGATGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153789.3-854s21c1
Sequence:CCGGAGAGGACTTTAGCCCTATTAACTCGAGTTAATAGGGCTAAAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-420s21c1
Sequence:CCGGCTGGCACCTTACCGCCTTAAACTCGAGTTTAAGGCGGTAAGGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-1594s21c1
Sequence:CCGGTGCAGTATTGTAAACTATAAGCTCGAGCTTATAGTTTACAATACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153789.2-380s1c1
Sequence:CCGGGCTGAATCTGAGAAACCGGATCTCGAGATCCGGTTTCTCAGATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-1133s1c1
Sequence:CCGGCCTTGGTAAGAAATACGTCTTCTCGAGAAGACGTATTTCTTACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-866s1c1
Sequence:CCGGCCCTATTAACAGGATAGCTTACTCGAGTAAGCTATCCTGTTAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-1154s1c1
Sequence:CCGGCGACATCAAGAGAACATCCAACTCGAGTTGGATGTTCTCTTGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-509s1c1
Sequence:CCGGGCACATTAAAGAGTCCCTCTTCTCGAGAAGAGGGACTCTTTAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153789
VALIDATED
MYLIP MISSION shRNA Lentiviral Transduction Particles
myosin regulatory light chain interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153789.3-1021s21c1
Sequence:CCGGCCGAAACACATGCATTCTATACTCGAGTATAGAATGCATGTGTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-318s21c1
Sequence:CCGGGGGATCATCGAGGTTGATTATCTCGAGATAATCAACCTCGATGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153789.3-854s21c1
Sequence:CCGGAGAGGACTTTAGCCCTATTAACTCGAGTTAATAGGGCTAAAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-420s21c1
Sequence:CCGGCTGGCACCTTACCGCCTTAAACTCGAGTTTAAGGCGGTAAGGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153789.3-1594s21c1
Sequence:CCGGTGCAGTATTGTAAACTATAAGCTCGAGCTTATAGTTTACAATACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153789.2-380s1c1
Sequence:CCGGGCTGAATCTGAGAAACCGGATCTCGAGATCCGGTTTCTCAGATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-1133s1c1
Sequence:CCGGCCTTGGTAAGAAATACGTCTTCTCGAGAAGACGTATTTCTTACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-866s1c1
Sequence:CCGGCCCTATTAACAGGATAGCTTACTCGAGTAAGCTATCCTGTTAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-1154s1c1
Sequence:CCGGCGACATCAAGAGAACATCCAACTCGAGTTGGATGTTCTCTTGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153789.2-509s1c1
Sequence:CCGGGCACATTAAAGAGTCCCTCTTCTCGAGAAGAGGGACTCTTTAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013262
VALIDATED
MYLIP MISSION shRNA Bacterial Glycerol Stock
myosin regulatory light chain interacting protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013262.3-2249s21c1
Sequence:CCGGCCCACAAGCCTTTCGATTATACTCGAGTATAATCGAAAGGCTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013262.3-1556s21c1
Sequence:CCGGTCAATCTGACTGTAATCTAATCTCGAGATTAGATTACAGTCAGATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_013262.3-387s21c1
Sequence:CCGGAGGTGAAAGTTTATGGCTAAACTCGAGTTTAGCCATAAACTTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_013262.3-633s21c1
Sequence:CCGGCCAGAACACTGCCAAGTATAACTCGAGTTATACTTGGCAGTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013262.3-1514s21c1
Sequence:CCGGAGCATGTCCAGCACGTCTATCCTCGAGGATAGACGTGCTGGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013262.3-456s1c1
Sequence:CCGGGCTTAAACTTAGAGTCAAGTTCTCGAGAACTTGACTCTAAGTTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013262.3-888s1c1
Sequence:CCGGCCCAATTAATAGGATAGCTTACTCGAGTAAGCTATCCTATTAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013262
VALIDATED
MYLIP MISSION shRNA shRNA Plasmid DNA
myosin regulatory light chain interacting protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013262.3-2249s21c1
Sequence:CCGGCCCACAAGCCTTTCGATTATACTCGAGTATAATCGAAAGGCTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013262.3-1556s21c1
Sequence:CCGGTCAATCTGACTGTAATCTAATCTCGAGATTAGATTACAGTCAGATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_013262.3-387s21c1
Sequence:CCGGAGGTGAAAGTTTATGGCTAAACTCGAGTTTAGCCATAAACTTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_013262.3-633s21c1
Sequence:CCGGCCAGAACACTGCCAAGTATAACTCGAGTTATACTTGGCAGTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013262.3-1514s21c1
Sequence:CCGGAGCATGTCCAGCACGTCTATCCTCGAGGATAGACGTGCTGGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013262.3-456s1c1
Sequence:CCGGGCTTAAACTTAGAGTCAAGTTCTCGAGAACTTGACTCTAAGTTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013262.3-888s1c1
Sequence:CCGGCCCAATTAATAGGATAGCTTACTCGAGTAAGCTATCCTATTAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013262
VALIDATED
MYLIP MISSION shRNA Lentiviral Transduction Particles
myosin regulatory light chain interacting protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013262.3-2249s21c1
Sequence:CCGGCCCACAAGCCTTTCGATTATACTCGAGTATAATCGAAAGGCTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013262.3-1556s21c1
Sequence:CCGGTCAATCTGACTGTAATCTAATCTCGAGATTAGATTACAGTCAGATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_013262.3-387s21c1
Sequence:CCGGAGGTGAAAGTTTATGGCTAAACTCGAGTTTAGCCATAAACTTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_013262.3-633s21c1
Sequence:CCGGCCAGAACACTGCCAAGTATAACTCGAGTTATACTTGGCAGTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013262.3-1514s21c1
Sequence:CCGGAGCATGTCCAGCACGTCTATCCTCGAGGATAGACGTGCTGGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013262.3-456s1c1
Sequence:CCGGGCTTAAACTTAGAGTCAAGTTCTCGAGAACTTGACTCTAAGTTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013262.3-888s1c1
Sequence:CCGGCCCAATTAATAGGATAGCTTACTCGAGTAAGCTATCCTATTAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)