EMAIL THIS PAGE TO A FRIEND

MYLK2

myosin light chain kinase 2

130 Gene Product Result for
Synonyms: KMLC MLCK MLCK2 skMLCK
UniProtKB ID: Q9H1R3, Q569L1, Q96I84
Gene ID:
Human(85366) Summary: This gene encodes a myosin light chain kinase, a calcium/calmodulin dependent enzyme, that is exclusively expressed in adult skeletal muscle. [provided by RefSeq, Jul 2008]
Mouse(228785) myosin, light polypeptide kinase 2, skeletal muscle
Rat(117558) myosin light chain kinase 2
Zebrafish(100169950) myosin light chain kinase 2
cow(533378) myosin light chain kinase 2
Horse(100053698) myosin light chain kinase 2
domestic cat(101095813) myosin light chain kinase 2
dog(477187) myosin light chain kinase 2
chicken(396356) myosin light chain kinase 2
sheep(101111897) myosin light chain kinase 2
domestic guinea pig(100724875) myosin light chain kinase 2
Domestic Rabbit(100009051) myosin light chain kinase 2
naked mole-rat(101712444) myosin light chain kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
I2764 ML-7 powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_130630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033118 Rosetta Predictions human pricing
NM_057209 Rosetta Predictions rat pricing
NM_001081044 Rosetta Predictions mouse pricing
XM_001005681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157966 predicted 1247
2 SASI_Hs01_00157967 predicted 1746
3 SASI_Hs01_00157968 predicted 1467
4 SASI_Hs01_00157969 predicted 1635
5 SASI_Hs01_00157970 predicted 1620
6 SASI_Hs01_00157971 predicted 1787
7 SASI_Hs01_00157972 predicted 1247
8 SASI_Hs01_00157973 predicted 1112
9 SASI_Hs01_00157974 predicted 1612
10 SASI_Hs02_00360846 predicted 1770
11 SASI_Hs01_00157975 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063470 predicted 596
2 SASI_Rn01_00063471 predicted 1715
3 SASI_Rn01_00063473 predicted 1782
4 SASI_Rn01_00063474 predicted 1117
5 SASI_Rn02_00267166 predicted 1632
6 SASI_Rn01_00063475 predicted 923
7 SASI_Rn01_00063476 predicted 1143
8 SASI_Rn01_00063477 predicted 1332
9 SASI_Rn01_00063479 predicted 612
10 SASI_Rn02_00267167 predicted 1813
11 SASI_Rn01_00063472 predicted 962
12 SASI_Rn01_00063478 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294621 predicted 209
2 SASI_Mm02_00294622 predicted 1781
3 SASI_Mm02_00294623 predicted 1769
4 SASI_Mm02_00294624 predicted 1610
5 SASI_Mm02_00294625 predicted 1746
6 SASI_Mm02_00294626 predicted 1760
7 SASI_Mm02_00294627 predicted 1550
8 SASI_Mm02_00294628 predicted 752
9 SASI_Mm02_00294629 predicted 1515
10 SASI_Mm02_00294630 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208100 predicted 1785
2 SASI_Mm01_00208101 predicted 1778
3 SASI_Mm01_00208102 predicted 1620
4 SASI_Mm01_00208103 predicted 1621
5 SASI_Mm01_00208104 predicted 1746
6 SASI_Mm01_00208105 predicted 1218
7 SASI_Mm01_00208106 predicted 1557
8 SASI_Mm01_00208107 predicted 1520
9 SASI_Mm01_00208108 predicted 1799
10 SASI_Mm01_00208109 predicted 1287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033118
VALIDATED
MYLK2 MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-945s1c1
Sequence:CCGGCATCAAGAAACAGACTCCCAACTCGAGTTGGGAGTCTGTTTCTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033118.x-2646s1c1
Sequence:CCGGGCTTGTGCCTTGTAAATAAATCTCGAGATTTATTTACAAGGCACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-1483s1c1
Sequence:CCGGCTATCTGGCAACTGGTACTTTCTCGAGAAAGTACCAGTTGCCAGATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1467s21c1
Sequence:CCGGTTATGACCAAATCTCCGATAACTCGAGTTATCGGAGATTTGGTCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-1254s1c1
Sequence:CCGGCGGGCATTTGGTGAAGATCATCTCGAGATGATCTTCACCAAATGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1764s21c1
Sequence:CCGGTAAGTCCCAGATCTTGCTTAACTCGAGTTAAGCAAGATCTGGGACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1569s21c1
Sequence:CCGGGACCCTAAACAACGTTCTATCCTCGAGGATAGAACGTTGTTTAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.3-1746s1c1
Sequence:CCGGACGCTGTAACCGACGCCTTAACTCGAGTTAAGGCGTCGGTTACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-984s1c1
Sequence:CCGGGCTGGAGATTGAGGTCATGAACTCGAGTTCATGACCTCAATCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-47s1c1
Sequence:CCGGCAACAGACAAGGCACCTAAAGCTCGAGCTTTAGGTGCCTTGTCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-1054s1c1
Sequence:CCGGCCGCATGAGATCGTCCTGTTCCTCGAGGAACAGGACGATCTCATGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_033118.3-2351s1c1
Sequence:CCGGGAAAGGCTGCAACGCTGATTCCTCGAGGAATCAGCGTTGCAGCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1344s21c1
Sequence:CCGGTGTCAACACCACCGGGCATTTCTCGAGAAATGCCCGGTGGTGTTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1721s21c1
Sequence:CCGGTCAACAACCTGGCGGAGAAAGCTCGAGCTTTCTCCGCCAGGTTGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033118
VALIDATED
MYLK2 MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-945s1c1
Sequence:CCGGCATCAAGAAACAGACTCCCAACTCGAGTTGGGAGTCTGTTTCTTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033118.x-2646s1c1
Sequence:CCGGGCTTGTGCCTTGTAAATAAATCTCGAGATTTATTTACAAGGCACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-1483s1c1
Sequence:CCGGCTATCTGGCAACTGGTACTTTCTCGAGAAAGTACCAGTTGCCAGATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1467s21c1
Sequence:CCGGTTATGACCAAATCTCCGATAACTCGAGTTATCGGAGATTTGGTCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-1254s1c1
Sequence:CCGGCGGGCATTTGGTGAAGATCATCTCGAGATGATCTTCACCAAATGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1764s21c1
Sequence:CCGGTAAGTCCCAGATCTTGCTTAACTCGAGTTAAGCAAGATCTGGGACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1569s21c1
Sequence:CCGGGACCCTAAACAACGTTCTATCCTCGAGGATAGAACGTTGTTTAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.3-1746s1c1
Sequence:CCGGACGCTGTAACCGACGCCTTAACTCGAGTTAAGGCGTCGGTTACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-984s1c1
Sequence:CCGGGCTGGAGATTGAGGTCATGAACTCGAGTTCATGACCTCAATCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-47s1c1
Sequence:CCGGCAACAGACAAGGCACCTAAAGCTCGAGCTTTAGGTGCCTTGTCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-1054s1c1
Sequence:CCGGCCGCATGAGATCGTCCTGTTCCTCGAGGAACAGGACGATCTCATGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_033118.3-2351s1c1
Sequence:CCGGGAAAGGCTGCAACGCTGATTCCTCGAGGAATCAGCGTTGCAGCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1344s21c1
Sequence:CCGGTGTCAACACCACCGGGCATTTCTCGAGAAATGCCCGGTGGTGTTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1721s21c1
Sequence:CCGGTCAACAACCTGGCGGAGAAAGCTCGAGCTTTCTCCGCCAGGTTGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033118
VALIDATED
MYLK2 MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-945s1c1
Sequence:CCGGCATCAAGAAACAGACTCCCAACTCGAGTTGGGAGTCTGTTTCTTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033118.x-2646s1c1
Sequence:CCGGGCTTGTGCCTTGTAAATAAATCTCGAGATTTATTTACAAGGCACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-1483s1c1
Sequence:CCGGCTATCTGGCAACTGGTACTTTCTCGAGAAAGTACCAGTTGCCAGATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1467s21c1
Sequence:CCGGTTATGACCAAATCTCCGATAACTCGAGTTATCGGAGATTTGGTCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.x-1254s1c1
Sequence:CCGGCGGGCATTTGGTGAAGATCATCTCGAGATGATCTTCACCAAATGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1764s21c1
Sequence:CCGGTAAGTCCCAGATCTTGCTTAACTCGAGTTAAGCAAGATCTGGGACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1569s21c1
Sequence:CCGGGACCCTAAACAACGTTCTATCCTCGAGGATAGAACGTTGTTTAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.3-1746s1c1
Sequence:CCGGACGCTGTAACCGACGCCTTAACTCGAGTTAAGGCGTCGGTTACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-984s1c1
Sequence:CCGGGCTGGAGATTGAGGTCATGAACTCGAGTTCATGACCTCAATCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-47s1c1
Sequence:CCGGCAACAGACAAGGCACCTAAAGCTCGAGCTTTAGGTGCCTTGTCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033118.2-1054s1c1
Sequence:CCGGCCGCATGAGATCGTCCTGTTCCTCGAGGAACAGGACGATCTCATGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_033118.3-2351s1c1
Sequence:CCGGGAAAGGCTGCAACGCTGATTCCTCGAGGAATCAGCGTTGCAGCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1344s21c1
Sequence:CCGGTGTCAACACCACCGGGCATTTCTCGAGAAATGCCCGGTGGTGTTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033118.3-1721s21c1
Sequence:CCGGTCAACAACCTGGCGGAGAAAGCTCGAGCTTTCTCCGCCAGGTTGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081044
MYLK2 MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-1702s21c1
Sequence:CCGGCGATGACACGGAGACCTTAAACTCGAGTTTAAGGTCTCCGTGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-760s21c1
Sequence:CCGGGACAACAGACCTCGTCTTTACCTCGAGGTAAAGACGAGGTCTGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-1603s21c1
Sequence:CCGGGGTGGTGAACTACGACCAAATCTCGAGATTTGGTCGTAGTTCACCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-243s21c1
Sequence:CCGGCAACAGAACAGACACCTAAAGCTCGAGCTTTAGGTGTCTGTTCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081044
MYLK2 MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-1702s21c1
Sequence:CCGGCGATGACACGGAGACCTTAAACTCGAGTTTAAGGTCTCCGTGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-760s21c1
Sequence:CCGGGACAACAGACCTCGTCTTTACCTCGAGGTAAAGACGAGGTCTGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-1603s21c1
Sequence:CCGGGGTGGTGAACTACGACCAAATCTCGAGATTTGGTCGTAGTTCACCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-243s21c1
Sequence:CCGGCAACAGAACAGACACCTAAAGCTCGAGCTTTAGGTGTCTGTTCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081044
MYLK2 MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-1702s21c1
Sequence:CCGGCGATGACACGGAGACCTTAAACTCGAGTTTAAGGTCTCCGTGTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-760s21c1
Sequence:CCGGGACAACAGACCTCGTCTTTACCTCGAGGTAAAGACGAGGTCTGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-1603s21c1
Sequence:CCGGGGTGGTGAACTACGACCAAATCTCGAGATTTGGTCGTAGTTCACCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081044.2-243s21c1
Sequence:CCGGCAACAGAACAGACACCTAAAGCTCGAGCTTTAGGTGTCTGTTCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130630
MYLK2 MISSION shRNA Bacterial Glycerol Stock
myosin light chain kinase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-846s1c1
Sequence:CCGGCGGAAATGTCAACAGTGAATTCTCGAGAATTCACTGTTGACATTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-1322s1c1
Sequence:CCGGCCAATGAGAAACTGAAGGTGACTCGAGTCACCTTCAGTTTCTCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-149s1c1
Sequence:CCGGCCTACCTCATGACTACAGAAACTCGAGTTTCTGTAGTCATGAGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-1197s1c1
Sequence:CCGGGATCCTCTTCATGCACAAGATCTCGAGATCTTGTGCATGAAGAGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-106s1c1
Sequence:CCGGCAGCTAGAAAGACTTGAGTTACTCGAGTAACTCAAGTCTTTCTAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130630
MYLK2 MISSION shRNA shRNA Plasmid DNA
myosin light chain kinase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-846s1c1
Sequence:CCGGCGGAAATGTCAACAGTGAATTCTCGAGAATTCACTGTTGACATTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-1322s1c1
Sequence:CCGGCCAATGAGAAACTGAAGGTGACTCGAGTCACCTTCAGTTTCTCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-149s1c1
Sequence:CCGGCCTACCTCATGACTACAGAAACTCGAGTTTCTGTAGTCATGAGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-1197s1c1
Sequence:CCGGGATCCTCTTCATGCACAAGATCTCGAGATCTTGTGCATGAAGAGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-106s1c1
Sequence:CCGGCAGCTAGAAAGACTTGAGTTACTCGAGTAACTCAAGTCTTTCTAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130630
MYLK2 MISSION shRNA Lentiviral Transduction Particles
myosin light chain kinase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-846s1c1
Sequence:CCGGCGGAAATGTCAACAGTGAATTCTCGAGAATTCACTGTTGACATTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-1322s1c1
Sequence:CCGGCCAATGAGAAACTGAAGGTGACTCGAGTCACCTTCAGTTTCTCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-149s1c1
Sequence:CCGGCCTACCTCATGACTACAGAAACTCGAGTTTCTGTAGTCATGAGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-1197s1c1
Sequence:CCGGGATCCTCTTCATGCACAAGATCTCGAGATCTTGTGCATGAAGAGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130630.4-106s1c1
Sequence:CCGGCAGCTAGAAAGACTTGAGTTACTCGAGTAACTCAAGTCTTTCTAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)